ID: 1140708401

View in Genome Browser
Species Human (GRCh38)
Location 16:77653096-77653118
Sequence TTGGAGAAATGCTGGTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140708401_1140708405 -1 Left 1140708401 16:77653096-77653118 CCTGTAGACCAGCATTTCTCCAA No data
Right 1140708405 16:77653118-77653140 AGTGTGGTTCTTGCACCCTCTGG No data
1140708401_1140708407 13 Left 1140708401 16:77653096-77653118 CCTGTAGACCAGCATTTCTCCAA No data
Right 1140708407 16:77653132-77653154 ACCCTCTGGATCAGACTCATGGG No data
1140708401_1140708406 12 Left 1140708401 16:77653096-77653118 CCTGTAGACCAGCATTTCTCCAA No data
Right 1140708406 16:77653131-77653153 CACCCTCTGGATCAGACTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140708401 Original CRISPR TTGGAGAAATGCTGGTCTAC AGG (reversed) Intergenic
No off target data available for this crispr