ID: 1140708403

View in Genome Browser
Species Human (GRCh38)
Location 16:77653104-77653126
Sequence AACCACACTTGGAGAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140708403_1140708405 -9 Left 1140708403 16:77653104-77653126 CCAGCATTTCTCCAAGTGTGGTT No data
Right 1140708405 16:77653118-77653140 AGTGTGGTTCTTGCACCCTCTGG No data
1140708403_1140708406 4 Left 1140708403 16:77653104-77653126 CCAGCATTTCTCCAAGTGTGGTT No data
Right 1140708406 16:77653131-77653153 CACCCTCTGGATCAGACTCATGG No data
1140708403_1140708407 5 Left 1140708403 16:77653104-77653126 CCAGCATTTCTCCAAGTGTGGTT No data
Right 1140708407 16:77653132-77653154 ACCCTCTGGATCAGACTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140708403 Original CRISPR AACCACACTTGGAGAAATGC TGG (reversed) Intergenic
No off target data available for this crispr