ID: 1140708404

View in Genome Browser
Species Human (GRCh38)
Location 16:77653115-77653137
Sequence GAGGGTGCAAGAACCACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140708404_1140708410 22 Left 1140708404 16:77653115-77653137 CCAAGTGTGGTTCTTGCACCCTC No data
Right 1140708410 16:77653160-77653182 CTTTGAACATACAGATTCCTAGG No data
1140708404_1140708407 -6 Left 1140708404 16:77653115-77653137 CCAAGTGTGGTTCTTGCACCCTC No data
Right 1140708407 16:77653132-77653154 ACCCTCTGGATCAGACTCATGGG No data
1140708404_1140708406 -7 Left 1140708404 16:77653115-77653137 CCAAGTGTGGTTCTTGCACCCTC No data
Right 1140708406 16:77653131-77653153 CACCCTCTGGATCAGACTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140708404 Original CRISPR GAGGGTGCAAGAACCACACT TGG (reversed) Intergenic
No off target data available for this crispr