ID: 1140708405

View in Genome Browser
Species Human (GRCh38)
Location 16:77653118-77653140
Sequence AGTGTGGTTCTTGCACCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140708403_1140708405 -9 Left 1140708403 16:77653104-77653126 CCAGCATTTCTCCAAGTGTGGTT No data
Right 1140708405 16:77653118-77653140 AGTGTGGTTCTTGCACCCTCTGG No data
1140708398_1140708405 20 Left 1140708398 16:77653075-77653097 CCACTGAAGTCCGCCTTCTCTCC No data
Right 1140708405 16:77653118-77653140 AGTGTGGTTCTTGCACCCTCTGG No data
1140708400_1140708405 7 Left 1140708400 16:77653088-77653110 CCTTCTCTCCTGTAGACCAGCAT No data
Right 1140708405 16:77653118-77653140 AGTGTGGTTCTTGCACCCTCTGG No data
1140708399_1140708405 10 Left 1140708399 16:77653085-77653107 CCGCCTTCTCTCCTGTAGACCAG No data
Right 1140708405 16:77653118-77653140 AGTGTGGTTCTTGCACCCTCTGG No data
1140708401_1140708405 -1 Left 1140708401 16:77653096-77653118 CCTGTAGACCAGCATTTCTCCAA No data
Right 1140708405 16:77653118-77653140 AGTGTGGTTCTTGCACCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140708405 Original CRISPR AGTGTGGTTCTTGCACCCTC TGG Intergenic
No off target data available for this crispr