ID: 1140708407

View in Genome Browser
Species Human (GRCh38)
Location 16:77653132-77653154
Sequence ACCCTCTGGATCAGACTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140708399_1140708407 24 Left 1140708399 16:77653085-77653107 CCGCCTTCTCTCCTGTAGACCAG No data
Right 1140708407 16:77653132-77653154 ACCCTCTGGATCAGACTCATGGG No data
1140708403_1140708407 5 Left 1140708403 16:77653104-77653126 CCAGCATTTCTCCAAGTGTGGTT No data
Right 1140708407 16:77653132-77653154 ACCCTCTGGATCAGACTCATGGG No data
1140708401_1140708407 13 Left 1140708401 16:77653096-77653118 CCTGTAGACCAGCATTTCTCCAA No data
Right 1140708407 16:77653132-77653154 ACCCTCTGGATCAGACTCATGGG No data
1140708400_1140708407 21 Left 1140708400 16:77653088-77653110 CCTTCTCTCCTGTAGACCAGCAT No data
Right 1140708407 16:77653132-77653154 ACCCTCTGGATCAGACTCATGGG No data
1140708404_1140708407 -6 Left 1140708404 16:77653115-77653137 CCAAGTGTGGTTCTTGCACCCTC No data
Right 1140708407 16:77653132-77653154 ACCCTCTGGATCAGACTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140708407 Original CRISPR ACCCTCTGGATCAGACTCAT GGG Intergenic
No off target data available for this crispr