ID: 1140708410

View in Genome Browser
Species Human (GRCh38)
Location 16:77653160-77653182
Sequence CTTTGAACATACAGATTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140708404_1140708410 22 Left 1140708404 16:77653115-77653137 CCAAGTGTGGTTCTTGCACCCTC No data
Right 1140708410 16:77653160-77653182 CTTTGAACATACAGATTCCTAGG No data
1140708409_1140708410 3 Left 1140708409 16:77653134-77653156 CCTCTGGATCAGACTCATGGGCA No data
Right 1140708410 16:77653160-77653182 CTTTGAACATACAGATTCCTAGG No data
1140708408_1140708410 4 Left 1140708408 16:77653133-77653155 CCCTCTGGATCAGACTCATGGGC No data
Right 1140708410 16:77653160-77653182 CTTTGAACATACAGATTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140708410 Original CRISPR CTTTGAACATACAGATTCCT AGG Intergenic
No off target data available for this crispr