ID: 1140710021

View in Genome Browser
Species Human (GRCh38)
Location 16:77668992-77669014
Sequence TTGTTGTTCAGAAGGAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140710021_1140710027 11 Left 1140710021 16:77668992-77669014 CCCTTTCTCCTTCTGAACAACAA No data
Right 1140710027 16:77669026-77669048 CCAGCCTTGCAGTGAGCCTTAGG No data
1140710021_1140710029 16 Left 1140710021 16:77668992-77669014 CCCTTTCTCCTTCTGAACAACAA No data
Right 1140710029 16:77669031-77669053 CTTGCAGTGAGCCTTAGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140710021 Original CRISPR TTGTTGTTCAGAAGGAGAAA GGG (reversed) Intergenic
No off target data available for this crispr