ID: 1140713405

View in Genome Browser
Species Human (GRCh38)
Location 16:77699213-77699235
Sequence AACCATAAAAATAATCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140713401_1140713405 -9 Left 1140713401 16:77699199-77699221 CCTTACCAGCCAAAAACCATAAA No data
Right 1140713405 16:77699213-77699235 AACCATAAAAATAATCAGGTAGG No data
1140713400_1140713405 2 Left 1140713400 16:77699188-77699210 CCAAACTGGAGCCTTACCAGCCA No data
Right 1140713405 16:77699213-77699235 AACCATAAAAATAATCAGGTAGG No data
1140713398_1140713405 20 Left 1140713398 16:77699170-77699192 CCAAAAAAACACTGTTCTCCAAA No data
Right 1140713405 16:77699213-77699235 AACCATAAAAATAATCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140713405 Original CRISPR AACCATAAAAATAATCAGGT AGG Intergenic
No off target data available for this crispr