ID: 1140714716

View in Genome Browser
Species Human (GRCh38)
Location 16:77712040-77712062
Sequence AACCTGCCCTTACTTCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140714716_1140714720 30 Left 1140714716 16:77712040-77712062 CCCCTCAGAAGTAAGGGCAGGTT No data
Right 1140714720 16:77712093-77712115 TCTCTTTTGCCCTACTGAGAGGG No data
1140714716_1140714719 29 Left 1140714716 16:77712040-77712062 CCCCTCAGAAGTAAGGGCAGGTT No data
Right 1140714719 16:77712092-77712114 TTCTCTTTTGCCCTACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140714716 Original CRISPR AACCTGCCCTTACTTCTGAG GGG (reversed) Intergenic
No off target data available for this crispr