ID: 1140714720

View in Genome Browser
Species Human (GRCh38)
Location 16:77712093-77712115
Sequence TCTCTTTTGCCCTACTGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140714717_1140714720 29 Left 1140714717 16:77712041-77712063 CCCTCAGAAGTAAGGGCAGGTTT No data
Right 1140714720 16:77712093-77712115 TCTCTTTTGCCCTACTGAGAGGG No data
1140714718_1140714720 28 Left 1140714718 16:77712042-77712064 CCTCAGAAGTAAGGGCAGGTTTA No data
Right 1140714720 16:77712093-77712115 TCTCTTTTGCCCTACTGAGAGGG No data
1140714716_1140714720 30 Left 1140714716 16:77712040-77712062 CCCCTCAGAAGTAAGGGCAGGTT No data
Right 1140714720 16:77712093-77712115 TCTCTTTTGCCCTACTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140714720 Original CRISPR TCTCTTTTGCCCTACTGAGA GGG Intergenic
No off target data available for this crispr