ID: 1140716551

View in Genome Browser
Species Human (GRCh38)
Location 16:77731328-77731350
Sequence TTTCCATCAATGATGGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140716549_1140716551 12 Left 1140716549 16:77731293-77731315 CCTTTCAAAATACAGTCATGTGC 0: 1
1: 2
2: 5
3: 46
4: 332
Right 1140716551 16:77731328-77731350 TTTCCATCAATGATGGACCATGG 0: 1
1: 0
2: 2
3: 6
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140716551 Original CRISPR TTTCCATCAATGATGGACCA TGG Intronic
902119719 1:14152798-14152820 TTCCCATCAATAATGTACAAGGG + Intergenic
904554801 1:31352973-31352995 TTCCCATCAATAATGCACAAGGG + Intronic
906847785 1:49213105-49213127 TTTCCTTCAATGGTGGAGAAGGG + Intronic
908549538 1:65194838-65194860 TTGCCATGAATGATGCATCAAGG - Intronic
911247868 1:95538800-95538822 TTTCATTTAATGATGTACCATGG + Intergenic
911509687 1:98795975-98795997 TTTCCAACCATAATGGTCCACGG - Intergenic
914427186 1:147588159-147588181 TTTCCTTCAATTATGGATCCAGG - Intronic
917688964 1:177448008-177448030 AATCCATCAATTATGGCCCAGGG - Intergenic
918179845 1:182077662-182077684 TTTCCACCAACAATGGACAAGGG - Intergenic
918612939 1:186512914-186512936 TTTCCAGCACAGATGGACCGGGG + Intergenic
919220543 1:194622829-194622851 TTTCCAGCAATATTGGTCCAGGG + Intergenic
919573316 1:199275732-199275754 TTTCCATCAATATTGTACAAGGG - Intergenic
922714393 1:227859390-227859412 TTTCCTTCAAGGACAGACCAAGG + Intergenic
1063439334 10:6059737-6059759 TTTCCATCAATGAGATTCCAGGG - Intronic
1066608605 10:37210353-37210375 TGTCCATCAATGATAGACATTGG - Intronic
1068455424 10:57249041-57249063 TTTAAATCTATGATGGACAAAGG - Intergenic
1068931013 10:62590232-62590254 ATTTCATCAATGAGGGAGCATGG + Intronic
1072016563 10:91352903-91352925 TGTCTATAAATGATGGCCCAAGG + Intergenic
1072195878 10:93116855-93116877 TTACCATCGAAGATGAACCAAGG + Intergenic
1072935776 10:99711751-99711773 TTTTCATAAATGCTGGACCCTGG - Intronic
1077830123 11:5858623-5858645 TTTGCAGCTATGATGGAACATGG + Intronic
1079695942 11:23482995-23483017 TTTGCATCAATTAAGGACAATGG - Intergenic
1080374605 11:31693548-31693570 TGTCCATCAATGATAGACACTGG - Intronic
1083704454 11:64504427-64504449 TTTCAACCAAATATGGACCAGGG + Intergenic
1085627342 11:78083484-78083506 TTGGCATCCATGATGGTCCAGGG - Intergenic
1085703799 11:78768323-78768345 TTTCCAACCATGATGACCCACGG + Intronic
1088152656 11:106764518-106764540 ATTACAACAATCATGGACCATGG - Intronic
1102863490 12:116356368-116356390 TATCCATCAAGGAAGGTCCAAGG + Intergenic
1104683123 12:130765931-130765953 GCTCCATCAATGTTGGAACACGG - Intergenic
1106452115 13:29892038-29892060 TTTCCATCATTGAAAGACAAAGG + Intergenic
1109814753 13:67565962-67565984 TTTCCATACATCATGGATCAAGG - Intergenic
1110056462 13:70980495-70980517 TTTCTATCAGTGATGAAGCAAGG - Intergenic
1113179641 13:107610847-107610869 TTTTCATCAGTGGGGGACCAGGG + Intronic
1114204726 14:20558254-20558276 TCTCCATCACTGATAGATCAAGG - Intronic
1115281825 14:31671752-31671774 ATTCCTTTAATGAAGGACCACGG + Intronic
1116019491 14:39442917-39442939 TTTCTATCCATGATGGACTGAGG + Intergenic
1116683261 14:48004609-48004631 TTCCCATCAATTATTTACCATGG - Intergenic
1116914156 14:50506013-50506035 TTTCCACATATGATGTACCACGG - Intronic
1118479117 14:66145560-66145582 TTTCCATCCTGGATGGGCCAGGG - Intergenic
1118905842 14:70022608-70022630 TGTCCAGCAGTGATGGACCGTGG + Intronic
1121256859 14:92537374-92537396 TGTCCATCAATAAGGGACCAGGG - Intronic
1122274257 14:100583321-100583343 TGTCCATGAATGATGGACAGAGG - Intronic
1124060030 15:26282787-26282809 TTTCCATCAATAATGTACTTGGG + Intergenic
1125051312 15:35300725-35300747 TTTCCATAAGTTATGTACCAAGG + Intronic
1127219973 15:56869581-56869603 TTTCAGTCAATGATGGACTGTGG - Intronic
1128657079 15:69470231-69470253 TTTGCATCAATGGTGGACTGGGG + Intergenic
1128917823 15:71581169-71581191 TTTCCATCAACAATGTACAAAGG + Intronic
1130967780 15:88710012-88710034 TTTCCATGAATAAAGGACCCAGG + Intergenic
1137354429 16:47746692-47746714 GTTCCAGTTATGATGGACCAAGG + Intergenic
1138369082 16:56510206-56510228 ATTCAATCAATGAAGGAACAGGG + Intronic
1140337852 16:74127643-74127665 TTTCAATAATTGATGGAACAAGG + Intergenic
1140716551 16:77731328-77731350 TTTCCATCAATGATGGACCATGG + Intronic
1141921948 16:87141581-87141603 TTTCCTTCCATGATGGACATAGG - Intronic
1142234918 16:88917514-88917536 TTTCCACCAATGAGGCGCCAGGG + Intronic
1142534768 17:606545-606567 TTTCCATCCATGACGGGCCACGG + Intronic
1143056678 17:4167868-4167890 TTGCCATAAATGCTCGACCAAGG - Exonic
1149083272 17:52683751-52683773 TTTCCATCAGAGAAGGACTATGG + Intergenic
1151848034 17:76671703-76671725 TTTCCCTCAGTGATTGACAAAGG - Intergenic
1158056645 18:53288420-53288442 TTTCCCTCAATTATGCAACATGG - Intronic
1159518594 18:69489364-69489386 TTCCTACCAGTGATGGACCATGG + Intronic
1159696414 18:71562528-71562550 TTTCCATCAACAATGTACAAGGG - Intergenic
1159701354 18:71631967-71631989 TTTCCCTGAATGCTGGACAAAGG - Intergenic
1161328578 19:3675487-3675509 TTTCTCTCCATCATGGACCAAGG + Intronic
1162599357 19:11655914-11655936 TTTCCATCAATAGTGTACAAGGG - Intergenic
1163817333 19:19474933-19474955 CTTCCATCAAAGAGGGACAAGGG - Intronic
1166288741 19:41848436-41848458 TTTCCAGCTGTGAAGGACCAGGG - Exonic
1168412850 19:56150610-56150632 TTTCCAGCAATGATACAACATGG + Intronic
925902713 2:8519862-8519884 TTTCCAGCAATGACAGCCCAGGG + Intergenic
926713339 2:15901846-15901868 TTCCCACCACTGATGCACCAGGG - Intergenic
927415435 2:22874399-22874421 ATTCCAGCAATGATGGTACATGG - Intergenic
928114060 2:28533231-28533253 TTTCCATCAATGTTCTTCCAAGG - Intronic
930679726 2:54243859-54243881 TTTCCATCAGTGATGGACTATGG - Intronic
936638083 2:114282095-114282117 TTTCCATCAATCATGTCCCATGG + Intergenic
937280263 2:120712816-120712838 TGTCCATCAAGAAGGGACCAGGG + Intergenic
938194148 2:129311509-129311531 TTACAATTAATGCTGGACCAGGG + Intergenic
942399063 2:175581702-175581724 TTTCCATCAGTCATGGAAAATGG + Intergenic
942718790 2:178925530-178925552 TTTTCATCTATGTTGAACCAAGG - Intronic
943005109 2:182379831-182379853 ATTCCATCCTTGATGGTCCAGGG + Intronic
945458616 2:210078599-210078621 TTTCCATAAATAATGGATGAAGG + Intronic
1172305175 20:33875497-33875519 TTCCCAGCAAGGATGGACCCAGG - Intergenic
1174058110 20:47813490-47813512 TTTCCATCAATAGTGCACAAGGG - Intergenic
1174090204 20:48040570-48040592 TTTTCAATAGTGATGGACCATGG + Intergenic
1178277887 21:31255390-31255412 TTTCCAGCAATGCTGGAGAATGG - Intronic
1178402857 21:32302042-32302064 TTTCCATCAAGGTAGCACCAGGG + Intronic
1182479153 22:30595594-30595616 TTCCCATCATTGGTGGACCCTGG + Intronic
950519554 3:13488854-13488876 TTTCCACCAGTAATGTACCAGGG + Intronic
951309842 3:21111280-21111302 TTCCCATCAATGATCTACAAGGG + Intergenic
953053291 3:39365993-39366015 TGCCCATCAATGATAGACTAAGG + Intergenic
960100106 3:113732865-113732887 TTTCCATCAGTAATGTATCAGGG + Intronic
961331432 3:126143482-126143504 TTTCCAACCATGATTGACCATGG + Intronic
962374198 3:134846773-134846795 TCAACCTCAATGATGGACCAGGG - Intronic
962545796 3:136433429-136433451 TTTTTATAAATGATGGACTATGG - Intronic
964773150 3:160245615-160245637 TTCCCAACAAAGATGGATCAAGG + Intronic
970693705 4:18649491-18649513 TTTCCATCAACAATGTACAAGGG - Intergenic
971552702 4:27976468-27976490 TTGGCATCCATGATGGCCCAGGG - Intergenic
971912095 4:32807587-32807609 TTTCTATCAGTGATGTACAAGGG + Intergenic
973079534 4:45972466-45972488 TGCCCATCAATGATAGACCGGGG + Intergenic
974210609 4:58769588-58769610 GTTCCATCAGTGATGGATTAGGG - Intergenic
974522426 4:63000305-63000327 TTCCCATCAATGGTGTACAAAGG - Intergenic
974907816 4:68078838-68078860 TTTCCATCACTCAGGGAACAGGG + Intronic
978025765 4:103872244-103872266 TTTCCATCATTCATGAACCTAGG + Intergenic
979584322 4:122397290-122397312 TTTCAAACAGTGATAGACCATGG + Intronic
980283905 4:130757447-130757469 TTTCCATCATGGAAGGAACAAGG + Intergenic
980630837 4:135430731-135430753 TTTCCTCCAATGTTAGACCAAGG + Intergenic
982052668 4:151517632-151517654 ATTCCATCTATCATTGACCAAGG - Intronic
982730320 4:158948892-158948914 TTTCCATTAATGGTGGGGCACGG - Intronic
986042175 5:4004533-4004555 TTGCCAACAGGGATGGACCAAGG + Intergenic
986719044 5:10546994-10547016 CTTCCATAAATGAAGGAACAAGG - Intergenic
988715139 5:33818693-33818715 TTTCCACCAATGGTGTACTAGGG + Intronic
991596710 5:68314136-68314158 TTTCCATTAAGGAGAGACCAAGG - Intergenic
993505880 5:88708079-88708101 TGTCTATCACTGATGGAACAGGG + Intergenic
994625304 5:102210867-102210889 TTTCCATCAACGGTGTACAAGGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996440786 5:123488209-123488231 TTTCCATAAATGAAGTACCTTGG - Intergenic
997491133 5:134277076-134277098 TTTCCATCTATAAGGGACTATGG + Intergenic
998968711 5:147568326-147568348 TTTTCACAAATGAGGGACCAAGG + Intergenic
1002609578 5:180406587-180406609 TTCCCATCAACGATGTACAAGGG - Intergenic
1005736129 6:28748273-28748295 TTTCCATGGATGAGGGAGCAGGG - Intergenic
1005815122 6:29544807-29544829 GTTCCATCAATGATTGATAATGG + Intergenic
1007237579 6:40401847-40401869 CCTCCATCAGTGATGCACCATGG + Intronic
1010406186 6:75508640-75508662 TTTCCAAAAATGTTGGACCATGG + Intergenic
1012402294 6:98851697-98851719 TTCCCACCAATAATGGACAAGGG - Intergenic
1012434138 6:99197027-99197049 TTTTCATGAATGAGGGTCCATGG - Intergenic
1012619311 6:101321080-101321102 TTTCCACCAGTGATGCACAAAGG + Intergenic
1015914100 6:138197650-138197672 TTTCCGTCAATGACGGACCACGG - Intronic
1022631604 7:32090626-32090648 TTTGGATCAAGGATGGATCAAGG + Intronic
1026302860 7:69113130-69113152 TCTCAATGAATGATGGACCTTGG - Intergenic
1031306706 7:120136902-120136924 TTTCCACCAATAATGTACAAGGG - Intergenic
1036109939 8:5887332-5887354 TGTCCATCAATGATAGACTGAGG + Intergenic
1036742462 8:11376675-11376697 TTTCCATGAATCATGACCCATGG + Intergenic
1043503295 8:80877146-80877168 TTTCCAGCAATGTGGGGCCAGGG - Intergenic
1044394169 8:91690060-91690082 TTTCCATCAACAATGTACAAAGG - Intergenic
1047189509 8:122665304-122665326 TCTCCTTCAATGATGGGGCATGG - Intergenic
1048010583 8:130452195-130452217 TTTCCAGCTATAATGGACCTTGG + Intergenic
1048020993 8:130538863-130538885 TTCCCATCAATGGTGCACAAAGG - Intergenic
1048146254 8:131846870-131846892 TTTCCATTAAAGATGGATTAAGG + Intergenic
1049295253 8:141829862-141829884 TTTCCAACATTCATGAACCATGG + Intergenic
1052507652 9:29376799-29376821 TTGCCATCAATGATGTGGCAAGG - Intergenic
1052788796 9:32854939-32854961 TCTGTATCAGTGATGGACCATGG + Intergenic
1054800402 9:69342605-69342627 TTTCAATCAATGAGTGGCCAAGG + Intronic
1057538690 9:95943899-95943921 TTTCCATCAACAATGCACAAGGG - Intronic
1188071525 X:25724277-25724299 TTTCTATCAATTATTGATCATGG + Intergenic
1189358926 X:40333392-40333414 TTTTCATCCATGATGGATCTTGG + Intergenic
1190443920 X:50503973-50503995 TTTCCAGCAATGATGGCTGAAGG - Intergenic
1193276517 X:79595024-79595046 TTTTAGTCAATGATGGACCATGG + Intergenic
1193327619 X:80199241-80199263 TTTCCATCAATAGTGTACTAAGG + Intergenic
1193605026 X:83556521-83556543 TTTCCATCAACAATGTACAAGGG + Intergenic
1195304649 X:103568890-103568912 TTTCCATCAACAATGCACAAGGG - Intergenic
1195537958 X:106030298-106030320 TTTCCCTGTATGATGCACCAAGG + Intergenic
1196125074 X:112088667-112088689 TTTCTATCAATAATGTACAAGGG + Intergenic
1201490335 Y:14534314-14534336 TTTCCAGAAATATTGGACCAGGG - Intronic