ID: 1140719492

View in Genome Browser
Species Human (GRCh38)
Location 16:77758494-77758516
Sequence CAGAGACTAGCTCCAAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140719492_1140719497 21 Left 1140719492 16:77758494-77758516 CCTGGATTTGGAGCTAGTCTCTG No data
Right 1140719497 16:77758538-77758560 CTGGATCTAGTCTCTGGATCTGG No data
1140719492_1140719496 15 Left 1140719492 16:77758494-77758516 CCTGGATTTGGAGCTAGTCTCTG No data
Right 1140719496 16:77758532-77758554 CTAGTTCTGGATCTAGTCTCTGG No data
1140719492_1140719494 2 Left 1140719492 16:77758494-77758516 CCTGGATTTGGAGCTAGTCTCTG No data
Right 1140719494 16:77758519-77758541 TCTGAATCTAGTCCTAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140719492 Original CRISPR CAGAGACTAGCTCCAAATCC AGG (reversed) Intergenic
No off target data available for this crispr