ID: 1140719494

View in Genome Browser
Species Human (GRCh38)
Location 16:77758519-77758541
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140719492_1140719494 2 Left 1140719492 16:77758494-77758516 CCTGGATTTGGAGCTAGTCTCTG No data
Right 1140719494 16:77758519-77758541 TCTGAATCTAGTCCTAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140719494 Original CRISPR TCTGAATCTAGTCCTAGTTC TGG Intergenic
No off target data available for this crispr