ID: 1140719497

View in Genome Browser
Species Human (GRCh38)
Location 16:77758538-77758560
Sequence CTGGATCTAGTCTCTGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140719492_1140719497 21 Left 1140719492 16:77758494-77758516 CCTGGATTTGGAGCTAGTCTCTG No data
Right 1140719497 16:77758538-77758560 CTGGATCTAGTCTCTGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140719497 Original CRISPR CTGGATCTAGTCTCTGGATC TGG Intergenic
No off target data available for this crispr