ID: 1140720176

View in Genome Browser
Species Human (GRCh38)
Location 16:77764514-77764536
Sequence CTCCCAAAACACCACGTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140720171_1140720176 24 Left 1140720171 16:77764467-77764489 CCCTCTGAAACATCAACTTGGCA No data
Right 1140720176 16:77764514-77764536 CTCCCAAAACACCACGTCATGGG No data
1140720172_1140720176 23 Left 1140720172 16:77764468-77764490 CCTCTGAAACATCAACTTGGCAA No data
Right 1140720176 16:77764514-77764536 CTCCCAAAACACCACGTCATGGG No data
1140720173_1140720176 -10 Left 1140720173 16:77764501-77764523 CCTTGACTGTAGCCTCCCAAAAC No data
Right 1140720176 16:77764514-77764536 CTCCCAAAACACCACGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140720176 Original CRISPR CTCCCAAAACACCACGTCAT GGG Intergenic
No off target data available for this crispr