ID: 1140721846

View in Genome Browser
Species Human (GRCh38)
Location 16:77779253-77779275
Sequence ATGAAGCAACGGAAAGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140721843_1140721846 25 Left 1140721843 16:77779205-77779227 CCTGAGCGACAGAGAAATATTCC No data
Right 1140721846 16:77779253-77779275 ATGAAGCAACGGAAAGATTAAGG No data
1140721842_1140721846 29 Left 1140721842 16:77779201-77779223 CCAGCCTGAGCGACAGAGAAATA 0: 2
1: 40
2: 1519
3: 29545
4: 147957
Right 1140721846 16:77779253-77779275 ATGAAGCAACGGAAAGATTAAGG No data
1140721844_1140721846 4 Left 1140721844 16:77779226-77779248 CCGTCTCAAAAAAAAAAAAAAAA 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091
Right 1140721846 16:77779253-77779275 ATGAAGCAACGGAAAGATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140721846 Original CRISPR ATGAAGCAACGGAAAGATTA AGG Intergenic
No off target data available for this crispr