ID: 1140721978

View in Genome Browser
Species Human (GRCh38)
Location 16:77780312-77780334
Sequence TTGGCCTATATCCAGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140721978_1140721984 8 Left 1140721978 16:77780312-77780334 CCAACCAACTGGATATAGGCCAA No data
Right 1140721984 16:77780343-77780365 TAAAAGGAACAAAACTTTCAGGG No data
1140721978_1140721983 7 Left 1140721978 16:77780312-77780334 CCAACCAACTGGATATAGGCCAA No data
Right 1140721983 16:77780342-77780364 ATAAAAGGAACAAAACTTTCAGG No data
1140721978_1140721980 -8 Left 1140721978 16:77780312-77780334 CCAACCAACTGGATATAGGCCAA No data
Right 1140721980 16:77780327-77780349 TAGGCCAATCCAACAATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140721978 Original CRISPR TTGGCCTATATCCAGTTGGT TGG (reversed) Intergenic
No off target data available for this crispr