ID: 1140721983

View in Genome Browser
Species Human (GRCh38)
Location 16:77780342-77780364
Sequence ATAAAAGGAACAAAACTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140721979_1140721983 3 Left 1140721979 16:77780316-77780338 CCAACTGGATATAGGCCAATCCA No data
Right 1140721983 16:77780342-77780364 ATAAAAGGAACAAAACTTTCAGG No data
1140721977_1140721983 8 Left 1140721977 16:77780311-77780333 CCCAACCAACTGGATATAGGCCA No data
Right 1140721983 16:77780342-77780364 ATAAAAGGAACAAAACTTTCAGG No data
1140721976_1140721983 9 Left 1140721976 16:77780310-77780332 CCCCAACCAACTGGATATAGGCC No data
Right 1140721983 16:77780342-77780364 ATAAAAGGAACAAAACTTTCAGG No data
1140721978_1140721983 7 Left 1140721978 16:77780312-77780334 CCAACCAACTGGATATAGGCCAA No data
Right 1140721983 16:77780342-77780364 ATAAAAGGAACAAAACTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140721983 Original CRISPR ATAAAAGGAACAAAACTTTC AGG Intergenic
No off target data available for this crispr