ID: 1140722940

View in Genome Browser
Species Human (GRCh38)
Location 16:77787863-77787885
Sequence CTGTGTATGTGCATGCATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140722938_1140722940 9 Left 1140722938 16:77787831-77787853 CCTGATAACAAAACAAAACGCCA No data
Right 1140722940 16:77787863-77787885 CTGTGTATGTGCATGCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140722940 Original CRISPR CTGTGTATGTGCATGCATGT TGG Intergenic
No off target data available for this crispr