ID: 1140723243

View in Genome Browser
Species Human (GRCh38)
Location 16:77789221-77789243
Sequence AACTCAGCTTTCGCACGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140723235_1140723243 23 Left 1140723235 16:77789175-77789197 CCGGGTCTGGAAGATTGCGCTAC 0: 1
1: 0
2: 0
3: 4
4: 29
Right 1140723243 16:77789221-77789243 AACTCAGCTTTCGCACGGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1140723233_1140723243 25 Left 1140723233 16:77789173-77789195 CCCCGGGTCTGGAAGATTGCGCT 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1140723243 16:77789221-77789243 AACTCAGCTTTCGCACGGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1140723234_1140723243 24 Left 1140723234 16:77789174-77789196 CCCGGGTCTGGAAGATTGCGCTA 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1140723243 16:77789221-77789243 AACTCAGCTTTCGCACGGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1140723239_1140723243 -9 Left 1140723239 16:77789207-77789229 CCGTCTGAGAGGACAACTCAGCT 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1140723243 16:77789221-77789243 AACTCAGCTTTCGCACGGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140723243 Original CRISPR AACTCAGCTTTCGCACGGGA GGG Intronic
916660498 1:166919214-166919236 ATCTCTGCTTTGGCAAGGGATGG - Exonic
917383940 1:174447902-174447924 ACCTCAGCTTTCGGGCGGGGGGG - Intronic
1076713103 10:132349872-132349894 GCCTCAGCTTTCCCACGGGGTGG + Intronic
1077031990 11:472488-472510 AACTCAGGTTTCGCCTGGGTGGG + Intronic
1097112503 12:56671499-56671521 TACTCAGCTATCACATGGGAGGG - Intronic
1104129895 12:125883426-125883448 ATCTCAGCTTTTGCTCAGGATGG - Intergenic
1108465511 13:50711281-50711303 AACTCAGCTTTGGCACATGGAGG + Intronic
1113609980 13:111637710-111637732 AACTCAGATATCTCAGGGGAAGG + Intronic
1120588386 14:86345501-86345523 GACTCAGCTTTCCCATGGGAAGG + Intergenic
1125505252 15:40264196-40264218 AACTCAGCTTTGTCCCAGGATGG - Intronic
1140723243 16:77789221-77789243 AACTCAGCTTTCGCACGGGAGGG + Intronic
1142386300 16:89767069-89767091 TACGCAGCTTTCGGACCGGAAGG - Intronic
1143210572 17:5184377-5184399 ATCTCAGCTTTGGCAGGGAAAGG - Exonic
1154399201 18:14019204-14019226 ATCTCAGATTTCTCACCGGAAGG - Intergenic
1158784864 18:60698506-60698528 AACTCAGCTTTTTCATGGAATGG - Intergenic
1161023459 19:2023044-2023066 AACTCAGCCTCCTCATGGGAGGG - Intronic
1163318859 19:16560293-16560315 ACCTCAGCTTTCTGACTGGAGGG - Intronic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
937205037 2:120230965-120230987 AAGTCAGCTTTGACAGGGGAGGG - Intergenic
946011340 2:216566347-216566369 AACTGAGCTTTAGCTCAGGAGGG + Intronic
1179298636 21:40086990-40087012 ATCTCAGCTTTAGCACTGAAAGG - Intronic
1185052286 22:48560118-48560140 GACTCGGCTTTCCCATGGGACGG - Intronic
954567868 3:51614103-51614125 CACTCAGCTCTCACAAGGGATGG - Intronic
960089808 3:113627825-113627847 AACTCTGCATTCACACAGGAAGG + Exonic
965313898 3:167166592-167166614 AACTCAGCTCTCTCACCAGATGG + Intergenic
976611108 4:87031178-87031200 CACTCAGATTTCTCACAGGATGG - Intronic
991040544 5:62170503-62170525 AACTCAGCTTTTCCACTGAACGG - Intergenic
992571649 5:78065348-78065370 GACTGAGCTTTGGCAGGGGAAGG + Intronic
999153879 5:149444209-149444231 AACTCTGCTTCAGCACTGGAGGG - Intergenic
1002062910 5:176636941-176636963 AACTCAGCATTCGAGTGGGATGG + Intronic
1009355214 6:62735541-62735563 AACTCAGCTTCCTCACAGCATGG + Intergenic
1023505693 7:40898002-40898024 AACACACCTTTCACACCGGAAGG - Intergenic
1033284407 7:140028022-140028044 AACTCAGCTTTAAAACGTGACGG - Intronic
1035698004 8:1614880-1614902 AACTCTGCTTTCAAACAGGAGGG - Intronic
1038975593 8:32692438-32692460 AACTGAGCTTTGGCCCTGGAAGG + Intronic
1040815397 8:51502830-51502852 AAGACAGCTTTCGCTTGGGAGGG + Intronic
1041904135 8:63013138-63013160 AAGTCAGCTTTGGCTGGGGAAGG + Intergenic
1045520165 8:102896530-102896552 AACTCAGCTTTGGTACTGGAGGG - Intronic
1048820569 8:138376602-138376624 AGCTCAGTTTTGGCATGGGAGGG - Intronic
1055302474 9:74896747-74896769 AACTCTGCCTTTGCATGGGAGGG - Intergenic
1189144366 X:38640606-38640628 AAGTCAGCTTTGGCAAGGGAAGG - Intronic