ID: 1140724236

View in Genome Browser
Species Human (GRCh38)
Location 16:77797724-77797746
Sequence CCCAGGAGCTTGGAGGTCAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140724236_1140724242 7 Left 1140724236 16:77797724-77797746 CCGATGACCTCCAAGCTCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 259
Right 1140724242 16:77797754-77797776 TTTCCTAAGAGAGAGCCTTTTGG 0: 1
1: 0
2: 2
3: 16
4: 207
1140724236_1140724244 16 Left 1140724236 16:77797724-77797746 CCGATGACCTCCAAGCTCCTGGG 0: 1
1: 0
2: 1
3: 17
4: 259
Right 1140724244 16:77797763-77797785 AGAGAGCCTTTTGGACATCTTGG 0: 1
1: 0
2: 0
3: 24
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140724236 Original CRISPR CCCAGGAGCTTGGAGGTCAT CGG (reversed) Intronic
900467816 1:2834291-2834313 CCCAGGATCTGGGAGGTGCTGGG + Intergenic
900812763 1:4820481-4820503 ACCAGGAGCTTGGAGTTCTGGGG - Intergenic
900856465 1:5189179-5189201 ACCATGACCTTGTAGGTCATGGG - Intergenic
900919651 1:5662225-5662247 ACCAGGAGCTCGGTGGGCATGGG + Intergenic
900972403 1:5998846-5998868 CCTAGTAGCTTGGAGGCCTTAGG - Intronic
901625000 1:10618824-10618846 CTCAGGAGCTTGGTGATCACAGG + Intronic
901672736 1:10865870-10865892 CCCAAGAGCTGTGAGGTCCTGGG + Intergenic
902680915 1:18043132-18043154 CTCAGTACCTAGGAGGTCATGGG - Intergenic
903277538 1:22231517-22231539 CCCAGGATCTGGGAGATGATGGG - Intergenic
904288306 1:29467968-29467990 CAGAGGAGCTGGGAGATCATAGG - Intergenic
904752140 1:32747644-32747666 CCCAGTGGCCTGGATGTCATAGG + Intronic
904931101 1:34088082-34088104 TGCAGGAGCTTGGAGGCCAAGGG + Intronic
906262482 1:44405046-44405068 CCAAAGAGCTTGGAAGTCTTGGG - Intergenic
906293814 1:44636831-44636853 CCAAGGAGCTGGGAGGGCACTGG - Intronic
908326863 1:63031591-63031613 CGCAGGGGCTTCCAGGTCATAGG + Intergenic
913092963 1:115492364-115492386 CCCAGGAGCCTGGAGAGCTTTGG + Intergenic
917854103 1:179087755-179087777 CCCAAGAGCTTGGATTTGATAGG + Intronic
918974891 1:191471141-191471163 AGCAGGAGCTTCTAGGTCATAGG - Intergenic
919870157 1:201814168-201814190 CCCAGGAGCTTGGGCAACATGGG + Intronic
919993949 1:202730401-202730423 CTCAGGAGCCTGTAGGTCACAGG - Intronic
923952517 1:238974698-238974720 TCCAGGAGCTTGGAGGAGGTAGG - Intergenic
1063252982 10:4294583-4294605 CCCAGGTACTTGGAGGTACTTGG + Intergenic
1065287383 10:24199144-24199166 CCCAGGAGTTTGGAGGAGTTTGG + Intronic
1067764007 10:49071618-49071640 CCCAGGAGCCAGGAGGCCACAGG - Intronic
1067845138 10:49713555-49713577 CCCAGGAGCTTGGCTTTCACAGG + Intergenic
1067925865 10:50507396-50507418 CCCAGGACCTTGGTGTTCCTGGG - Intronic
1069834283 10:71299042-71299064 CCCCGGAGCCTGGAGGTGAAGGG - Intronic
1070362986 10:75708631-75708653 CACAGGAGATAGGAGATCATTGG + Intronic
1070776196 10:79111265-79111287 TGCAGGGGCTCGGAGGTCATGGG + Intronic
1072015395 10:91341819-91341841 AGCAGGAGCTTACAGGTCATAGG - Intergenic
1072276157 10:93825491-93825513 CCCAGGAGCTTGGAGGAAGGAGG + Intergenic
1072700750 10:97639830-97639852 CGCAGGAACTTGAAGGTAATGGG - Intronic
1073162732 10:101414130-101414152 GCCAGGAGCTGAGAGGTGATGGG - Intronic
1075407689 10:122205469-122205491 CACAGGAACTTGGAGCTCAAAGG + Intronic
1076440212 10:130476401-130476423 CACAGGAGCTGGGAGGACACAGG - Intergenic
1076872502 10:133200730-133200752 CCCAGGACCTTGGAGGTGGGGGG + Intronic
1077097356 11:804760-804782 CCGTGGAGCTGCGAGGTCATAGG + Intronic
1077388971 11:2290534-2290556 CCCAGGAGCGTGGAGCTCACTGG + Intergenic
1079997094 11:27305814-27305836 CCCAGAAGCTTGGAGGTGCCAGG - Intergenic
1080485831 11:32705352-32705374 CCCAGAAGCTTGGAGATGCTAGG - Intronic
1080690612 11:34554745-34554767 CCCAGAAGGTCGGAGGTCAGTGG - Intergenic
1080966909 11:37224186-37224208 CCCAGAAGCTTGGAGTTGCTAGG + Intergenic
1081723379 11:45306442-45306464 CCCAGGATCCTGGGGGTCCTGGG - Intergenic
1082124740 11:48418842-48418864 TCCTGGAGCTTGGAGCTCTTAGG + Intergenic
1082251313 11:49983925-49983947 TCCTGGAGCTTGGAGCTCTTAGG - Intergenic
1083717752 11:64588155-64588177 TCTAGCAGCATGGAGGTCATTGG + Intergenic
1085146051 11:74198700-74198722 CCCAGCACTTTGGAGGTCAAGGG - Intronic
1086436837 11:86790159-86790181 CCCTGAAGCTTGGAGATCGTTGG + Intergenic
1086656940 11:89369285-89369307 CACAGGGGCTGGGAGGACATAGG + Intronic
1087266867 11:96070470-96070492 CCCAGAAGCTTGGAGATGACAGG - Intronic
1090740781 11:129658276-129658298 CCCAGGAACTTGGTTGTCGTAGG - Intergenic
1092645746 12:10570156-10570178 AGCAGGGGCTTGCAGGTCATAGG - Intergenic
1093474503 12:19539694-19539716 CGCAGGGCCTTAGAGGTCATAGG + Intronic
1096793012 12:54056775-54056797 GCCAGGACCTGGGAGGTTATAGG - Intergenic
1101484238 12:105136203-105136225 AACAGGAGCTTGGGGCTCATCGG - Intronic
1103036838 12:117663842-117663864 CCCACGAGCTTGCAGGTTGTTGG + Intronic
1103150804 12:118636948-118636970 CCCAGGAAAGTGGATGTCATTGG - Intergenic
1104473890 12:129054380-129054402 AGCAGGAGCTTTGGGGTCATAGG - Intergenic
1104983563 12:132584595-132584617 CCCAGGGGCTGGGAGGTCGCTGG - Exonic
1106416727 13:29551958-29551980 CCCAGGAACTTGAAGCTTATGGG + Intronic
1107125557 13:36841890-36841912 GGCAGGAGCTTGGAGGTAAAGGG - Intergenic
1107497064 13:40936868-40936890 ACCAGGAGCTGGGAGGTGAAGGG + Intronic
1111370120 13:87306504-87306526 CTCTGGAGCTCGGATGTCATTGG + Intergenic
1112098255 13:96158828-96158850 CCCAGGAACCAGGAGGTCACTGG + Intronic
1112963828 13:105162180-105162202 CCAGGGTGCCTGGAGGTCATAGG + Intergenic
1113582179 13:111437558-111437580 CCCAGCAGCCTGGGGGTCAGGGG - Intergenic
1115648721 14:35387905-35387927 CCCAGCAGCTTGCTGGTCACTGG - Intergenic
1118346134 14:64942533-64942555 CCCAGGCGCCTGGTGGTCCTTGG - Exonic
1120259739 14:82167457-82167479 CCCAGTAATTTGGGGGTCATTGG + Intergenic
1120799081 14:88669269-88669291 CCCAGGAACTTGGTAGTCTTCGG - Intronic
1121659613 14:95625005-95625027 TCCAGGCTATTGGAGGTCATGGG + Intergenic
1122264030 14:100538471-100538493 CCCCTGAGCGTGGAGGACATCGG - Exonic
1125441114 15:39704647-39704669 TAAAGGGGCTTGGAGGTCATTGG - Intronic
1125790959 15:42365393-42365415 CCAAGGAGCTTGGAGGACAGTGG - Intronic
1127918726 15:63476531-63476553 ACCAGGAGCAGGGAGGACATGGG + Intergenic
1128557509 15:68641684-68641706 CCCAAGCCCTTGGAGGTGATGGG + Intronic
1129271483 15:74421519-74421541 GCCAGGAACCTGGGGGTCATGGG - Intronic
1129456287 15:75677580-75677602 CCCAGGACCTGGGAAGTCACAGG - Intronic
1130379633 15:83360367-83360389 CCCGGGAGCTGGGAGGTGAGGGG - Intergenic
1130739828 15:86587298-86587320 CCAAGGAGCATAGAGGTCAGAGG - Intronic
1131607680 15:93926055-93926077 CCCAGCAGCCTGGCTGTCATGGG - Intergenic
1131999144 15:98162399-98162421 CCCAGAAGCTTGGAGGTGCCAGG + Intergenic
1132137090 15:99351879-99351901 CCAAGGAGCAAGGTGGTCATTGG + Intronic
1132558510 16:583179-583201 ACCTTGGGCTTGGAGGTCATTGG + Exonic
1132578875 16:676160-676182 CCCAGGAGCTGGCAGGGCACTGG - Intronic
1132663344 16:1071115-1071137 CCCAGGTGCTTGGAGGTGGGGGG + Intergenic
1132843358 16:1989348-1989370 CCCAGGAGTAGGGAGGGCATTGG + Intergenic
1133695856 16:8261740-8261762 CCCAGGAGTTTGGGGGCCTTTGG + Intergenic
1139469347 16:67170053-67170075 CCCAGGAGGGTGGAGGTGCTTGG + Intergenic
1140724236 16:77797724-77797746 CCCAGGAGCTTGGAGGTCATCGG - Intronic
1141204043 16:81919629-81919651 TCCAGGAGCTCGGGGGTCACGGG - Exonic
1141363725 16:83422690-83422712 CACATGAGCTTAGAGGTCAGAGG - Intronic
1141930843 16:87201760-87201782 GGCAGGAGCTTGGAGGTCAGAGG - Intronic
1142126607 16:88413749-88413771 CCCAGGAGCTGGGATGTCCCTGG - Intergenic
1142253518 16:89003104-89003126 CGCAGGAGCTGGGGGGACATAGG + Intergenic
1144734559 17:17547762-17547784 CACGGGCGCTTGGAGGTCCTGGG - Intronic
1145822325 17:27848549-27848571 ACCAGGGGCTTACAGGTCATAGG - Intronic
1147844167 17:43393264-43393286 CTCAGGAGCCTGGAGCTCAGGGG - Intergenic
1148481316 17:47961282-47961304 GCCAGGAGATTGGAGATCCTGGG + Intergenic
1148483831 17:47977827-47977849 TCCAGGATCCTGGAGGTGATGGG + Exonic
1150590737 17:66559972-66559994 CCCAGGAGCCTGGAGCACATTGG + Intronic
1150807167 17:68328640-68328662 ACCAGGAGCTTGTAGGTGAAAGG + Intronic
1151257158 17:72886784-72886806 CCCTGGAGCTTGTAGGTGCTTGG - Intronic
1151390844 17:73785799-73785821 CCTAGGAGCTGTGAGGTCTTGGG + Intergenic
1151738261 17:75960244-75960266 GCCTGGAACTTGGAGATCATTGG - Exonic
1152193946 17:78905183-78905205 CCCAGGAGCTCTGAGGTCCAAGG - Intronic
1152430389 17:80245647-80245669 ACCAGGAGCTAGGAGGGCTTTGG - Intronic
1152930902 17:83109432-83109454 CCCAGGAGCTCAGAGGCCCTGGG + Intergenic
1156963681 18:43063860-43063882 AACAAGAGCTGGGAGGTCATAGG + Intronic
1158550334 18:58430594-58430616 CCCAGGAGCCTGGTGGGAATAGG + Intergenic
1158879918 18:61768337-61768359 CCCAGGAACTTGGGGATTATAGG - Intergenic
1159282303 18:66301845-66301867 TCCAGGAGCTAGGAGATAATAGG + Intergenic
1160103334 18:75945002-75945024 CCTAGGAGGTAGGAGGTCAGGGG + Intergenic
1160784305 19:892553-892575 CCCTGGAGATTGGGGGTTATAGG - Intronic
1161844692 19:6706234-6706256 CCCAGGACATTGGAGGTCTGAGG - Intronic
1162739274 19:12764934-12764956 CCCAGCAGCGTGGAGCTGATGGG - Intronic
1163485044 19:17580522-17580544 CCCAGGGGTCTGGCGGTCATGGG - Intronic
1163578064 19:18122142-18122164 CCCAGGGGGTGGGGGGTCATGGG + Intronic
1163658412 19:18561844-18561866 CCCAGGAATTTGGAGGTATTGGG - Intronic
1164179861 19:22808631-22808653 GGCAGGAGCTTCCAGGTCATAGG + Intergenic
1164398751 19:27888401-27888423 GCCAGGATCTTGGAAGTCAGAGG + Intergenic
1164426834 19:28149156-28149178 CCTAGGTGCCTGGGGGTCATGGG + Intergenic
1164473031 19:28551660-28551682 GCCAGGGGCTTCCAGGTCATAGG - Intergenic
1164545934 19:29162923-29162945 TCCAGGAGCAGGGAGGTCTTGGG - Intergenic
1165045939 19:33105070-33105092 CCCAGGAGCTAGGAGGGGAGTGG - Intronic
1165046479 19:33108707-33108729 CCCAGGAGCTTGGAGGGCAGTGG - Intronic
1165541640 19:36496995-36497017 CTCAGGAGGTTGTAAGTCATTGG + Intergenic
1166395177 19:42434399-42434421 CCCAGCAACTTGGAGGTCAAGGG - Intronic
1166723185 19:45009406-45009428 CCCAGGGTCCTGGAGGTCACTGG - Intronic
1167033874 19:46981618-46981640 CTCAGGAGCTTGGAAATCAATGG - Intronic
1167507835 19:49880531-49880553 CCCAGGAGCATGGAAGTGAATGG + Intronic
925234141 2:2263300-2263322 CCCTGGAGCTGGGAGGTGATTGG - Intronic
927033939 2:19152048-19152070 CACAGGGGCTTCCAGGTCATAGG + Intergenic
928013097 2:27629078-27629100 CCCAGAAGCCTGGAGCTCAGCGG - Exonic
931559969 2:63550254-63550276 CCAAGGAGAATGGTGGTCATTGG - Intronic
932590325 2:73062296-73062318 CCCAGAAGCCTTGAGGCCATTGG - Intronic
933079920 2:77972939-77972961 TCGGGGAGCTTTGAGGTCATAGG - Intergenic
933832177 2:86219896-86219918 CCCTGGAGATTGGGGGTCCTGGG - Intronic
934923720 2:98366790-98366812 CCCAGGAGCTCGGTAGTCTTAGG + Intronic
937111072 2:119367449-119367471 GCCGAGAGCTTGGAGGTCAGGGG + Intronic
937534955 2:122874933-122874955 GTCAGGAGTTTGGAGGTCACTGG - Intergenic
937775373 2:125769639-125769661 CTGAGGAGCTTCCAGGTCATAGG + Intergenic
944911706 2:204316862-204316884 CCCAGGAAATTGGATGTCAGTGG - Intergenic
945403854 2:209422543-209422565 CCCAGGAGCTGGGAGGTTGGAGG - Intergenic
946281988 2:218672337-218672359 CTGAGGAGCTTGGAGCTCCTAGG + Exonic
946333438 2:219022886-219022908 CCCCAAAGCTGGGAGGTCATTGG - Intronic
947736487 2:232457968-232457990 ACAAGGAGCTTGGTGGTGATTGG - Intronic
948715134 2:239856355-239856377 TCCTGGATCTTGGAGGCCATAGG - Intergenic
948831994 2:240602739-240602761 CCCAGGAGCCTGGAGGGAGTGGG - Intronic
1169486922 20:6041794-6041816 CCCAGGAGCTTGCTGGCCAGTGG + Exonic
1170132087 20:13031635-13031657 CCCAGCCTCATGGAGGTCATGGG - Intronic
1170984402 20:21244680-21244702 CCCAGGAGCTGGGAGGAACTGGG - Intronic
1171020482 20:21580251-21580273 CCAAGGAGCTGGGAGGAGATGGG - Intergenic
1171194943 20:23189597-23189619 CGCAAGAGCTTGGAAGTCCTGGG + Intergenic
1172132848 20:32667222-32667244 TCCAAGAGCTTCGAGGTCGTGGG + Intergenic
1172580196 20:36041398-36041420 CCCAGGAGCCTGAAGGTGAGGGG - Intergenic
1172934952 20:38613475-38613497 CCCAGCAGTTTGGGTGTCATTGG + Intronic
1173659722 20:44724902-44724924 CCCAGGAGGGTCGAGGTCCTGGG + Exonic
1174274561 20:49394353-49394375 CCCAGAAGCTTGCGGCTCATGGG - Intronic
1175086325 20:56462133-56462155 CCCTGGGACTTGGAGGACATGGG - Intergenic
1175312784 20:58023635-58023657 CCCAGAAGCTTGGAGGTGCCAGG + Intergenic
1175477744 20:59288835-59288857 CCCAGGAGGTGGAAGGTCAATGG - Intergenic
1176004695 20:62854387-62854409 CCAGGGAGCTTGTGGGTCATGGG - Intronic
1176086016 20:63295897-63295919 CCCAGGAGCTTGCAGGTGCCGGG - Intronic
1178402411 21:32298241-32298263 CCCAAGAGCTTGGACCACATGGG + Intronic
1180170194 21:46054630-46054652 CCGCAGGGCTTGGAGGTCATGGG - Intergenic
1180933705 22:19610515-19610537 CTCAGGAGCAGGCAGGTCATGGG - Intergenic
1181510532 22:23386883-23386905 CCCAGGGACAGGGAGGTCATGGG + Intergenic
1182433368 22:30314261-30314283 CTGAGGAGCTTGGAGCTCAGTGG + Intronic
1182969773 22:34562861-34562883 TTCATGAGATTGGAGGTCATTGG + Intergenic
1183551635 22:38490695-38490717 TCCAGGATCTTGTAGGACATTGG + Intronic
1183604274 22:38859626-38859648 CCCAAGAGCTTGGGGTTCAGGGG + Intergenic
1184704083 22:46198337-46198359 CCCAGTAGCTTGGAGCTCGGCGG + Exonic
1184834502 22:47013147-47013169 CCCAGGATCTTTGAGGTGCTGGG + Intronic
951323432 3:21274535-21274557 CCCAAGAGTTTCTAGGTCATTGG + Intergenic
953099637 3:39811315-39811337 CCAAGGAACTTGGAGTTCATAGG + Intronic
953289943 3:41650430-41650452 TCCAGAAGCTTGGAGGTGCTGGG - Intronic
953424255 3:42780151-42780173 CCCAGGAGGTTTGAGCTCAGGGG + Intronic
953749616 3:45599332-45599354 GCCAGGAGCTGGGAGGGGATGGG - Intronic
954684321 3:52362178-52362200 GCCAGGAGCTGGAAGGCCATGGG + Intronic
956408867 3:68957844-68957866 CTCAGGAGAATGGATGTCATGGG - Intergenic
960622487 3:119650468-119650490 CTCAGCAGCTTAGAGGTCATTGG - Intronic
960969849 3:123131546-123131568 CCCAGGAGCTGAGAGGGCATGGG + Intronic
961676150 3:128568085-128568107 CTCTGGAGCGTGGAGGTCCTGGG - Intergenic
964275867 3:155008486-155008508 ACCAGGAGCTTGGAGTCCAGTGG - Intergenic
965288840 3:166849901-166849923 CCCAGGAACTTGGTAGTCTTGGG + Intergenic
966305646 3:178531053-178531075 CCCAGGAGATGGGAGGTCAGGGG - Intronic
966423499 3:179756942-179756964 CCCAGGAGTGGGGAGGGCATTGG + Intronic
967708481 3:192679488-192679510 CTCAGGAGGTGGGAGGTCAGAGG + Intronic
967867857 3:194204622-194204644 CACAGGGGCTTGGAAGTCAGGGG - Intergenic
967920325 3:194609521-194609543 CTTAGCAGCTTGGAGGTCATCGG + Intronic
975484970 4:74925896-74925918 ACTAGGAGCTTCCAGGTCATAGG + Intergenic
975717316 4:77217370-77217392 CCCAGAAGCCTGGAGCTCAAAGG + Intronic
975814654 4:78205275-78205297 CACTGCAGCTTGGAGTTCATAGG + Intronic
976922592 4:90457211-90457233 CCCAGCAGCTTGGAGATCCCAGG + Intronic
977359186 4:95981752-95981774 CCCAGAAGCTTGGAGATGCTAGG - Intergenic
977876944 4:102161407-102161429 CCTGGTAGCTAGGAGGTCATTGG - Intergenic
977922438 4:102660322-102660344 CCCAAGGTCATGGAGGTCATAGG - Intronic
978323119 4:107520095-107520117 CCCAGGAGATTGGAGGTTGGAGG + Intergenic
980663969 4:135904239-135904261 CCCAAGAGCAAGGAGGTCATAGG + Intergenic
981222000 4:142248032-142248054 CACAGGAGCCTGGAGGGCAGGGG - Intronic
982168326 4:152636735-152636757 CCCAGAAGCATGGTGGTCGTAGG + Intronic
982957801 4:161793017-161793039 CCCAGAAGCTTGGAGATGACAGG - Intronic
984852990 4:184169597-184169619 CCCAGGAGCTGTGAGCTCAGAGG - Intronic
984962113 4:185107879-185107901 AGCAGGAGCTTCCAGGTCATAGG + Intergenic
985748933 5:1663549-1663571 GGCAGGAGCTGGGAGGTCAGGGG + Intergenic
985827696 5:2205048-2205070 CCAAGGACCCTGGAGGTCTTGGG + Intergenic
987677029 5:21087736-21087758 AACAGGAGCTTCCAGGTCATAGG - Intergenic
987680452 5:21129783-21129805 AGCAGGAGCTTCCAGGTCATAGG + Intergenic
990161865 5:52949926-52949948 CCCACCAGTTTGGAGTTCATTGG + Intronic
992177469 5:74164660-74164682 CCCAGGTGCTGGGAGGTGTTGGG - Intergenic
992571658 5:78065403-78065425 CCCGGGAGCTCGGTGGTCTTAGG - Intronic
992645137 5:78804760-78804782 TCCGGGAGCTGGGAGGTCAGAGG - Intronic
995109846 5:108417101-108417123 AGCAGGAGCTTCTAGGTCATAGG - Intergenic
995135776 5:108678591-108678613 CTCAGCAGCCTGGTGGTCATGGG + Intergenic
998763962 5:145464054-145464076 CACAGGCCTTTGGAGGTCATTGG - Intergenic
1001459734 5:171900805-171900827 CCTAGAATCTTAGAGGTCATTGG + Intronic
1001659817 5:173383046-173383068 CCCAGGAGCTAGGAGGTGTCAGG + Intergenic
1004760045 6:18656497-18656519 CCCAGGAGCTTGGCAGGCTTAGG - Intergenic
1004860913 6:19804069-19804091 CACAGGAGATTGGTGGTCTTGGG - Intergenic
1005278046 6:24241105-24241127 CCCAGGTGGCTGAAGGTCATGGG - Intronic
1006132003 6:31875143-31875165 GCCAGGAGCTGGGAGGTGACTGG - Intronic
1006152422 6:31996586-31996608 CCCAGGAGACTGGAGGTGAGGGG + Exonic
1006158727 6:32029324-32029346 CCCAGGAGACTGGAGGTGAGGGG + Exonic
1007363078 6:41372499-41372521 CCCCAGAGCTTGGGAGTCATGGG + Intergenic
1015096121 6:129416971-129416993 CCCAGGAGCTTGGAGATGCCAGG + Intronic
1015163159 6:130175275-130175297 CTCAGCACCTGGGAGGTCATGGG - Intronic
1016200095 6:141395662-141395684 CCCAGAAGCTTGGAGGTGCTAGG - Intergenic
1016699992 6:147043524-147043546 CATAGGATCTTGGAGGCCATAGG - Intergenic
1018176726 6:161183899-161183921 CCCAGGAGGGTGGAGCTCAGTGG + Intronic
1018860078 6:167704799-167704821 ACCAGGAGCTTGGAGTACAGTGG - Intergenic
1019360600 7:602470-602492 CCCGGGAGCCTGGAGGCCAACGG + Intronic
1021431041 7:20559624-20559646 CCCAGAAGCTTGGAGACTATAGG + Intergenic
1021906404 7:25338538-25338560 GCCTGGAGTTTTGAGGTCATGGG + Intergenic
1023120303 7:36902359-36902381 CACAGGAGCTTAGAGCTCAGAGG - Intronic
1023182991 7:37504472-37504494 CCCAGGAGGTTGGAGTGCAGTGG - Intergenic
1025007066 7:55363316-55363338 CCCCGGAGGTGGGAGGTCACTGG - Intergenic
1025142084 7:56474965-56474987 CCAAGGATCCTGGAGCTCATCGG + Intergenic
1026119223 7:67522162-67522184 AGCAGGAGCTTTCAGGTCATAGG - Intergenic
1026963987 7:74427607-74427629 CCCAGGAGCCTGGACCTCATAGG - Intergenic
1027232806 7:76282179-76282201 CCCTGGAGTTTGGAGGTCAGTGG - Intronic
1029087653 7:98023797-98023819 CCCAGGAGTTTGGCATTCATTGG + Intergenic
1031390094 7:121203286-121203308 CCCAGGAGAAAGGAGGTAATAGG - Intronic
1032018626 7:128394624-128394646 CCCAGCAGCTTGAAGCTCAGAGG + Intronic
1035039467 7:155917037-155917059 TTCTGGAGCTTGGAGGACATCGG - Intergenic
1035275560 7:157746111-157746133 GCCAAGAGCATGGAGATCATGGG + Intronic
1035275600 7:157746265-157746287 GCCAAGAGCATGGAGATCATGGG + Intronic
1035277771 7:157758293-157758315 CCCAGGAGCGTGCAGGCCACGGG - Intronic
1035428145 7:158796003-158796025 GCCAGCAGCCTGGAGATCATGGG + Intronic
1035772174 8:2156437-2156459 CCCAGAAGCTTTGAGGTCTCTGG - Intronic
1035922884 8:3696986-3697008 CCCAGGATCCAGTAGGTCATGGG + Intronic
1037991274 8:23322886-23322908 CCCAGGAACTGGGAGCTCTTCGG - Intronic
1038625804 8:29192314-29192336 ACCAGGTGCCTGGAGGTGATTGG - Intronic
1039018584 8:33180721-33180743 CACAGGGGCTTCCAGGTCATAGG + Intergenic
1041825586 8:62093232-62093254 CTGAGGAGCTAGGAGGACATTGG - Intergenic
1045017150 8:98009887-98009909 TCCAGGAGCTTGCAGGCCAGTGG - Intronic
1045017155 8:98009903-98009925 TCCTGGAGGTTGGAGGTCAGAGG + Intronic
1045144138 8:99320326-99320348 CCCAGGAGAAGGGAGGTCCTTGG - Intronic
1046762743 8:118038422-118038444 GTCAGATGCTTGGAGGTCATTGG - Intronic
1050265721 9:3887556-3887578 CGCAGAAGTTTGGAGCTCATGGG - Intronic
1050352743 9:4755811-4755833 AGCAGGAGCTTACAGGTCATAGG + Intergenic
1051138373 9:13950355-13950377 CCCAGTAGCTTGAAGGACATAGG + Intergenic
1051437094 9:17044440-17044462 CCCAGGTGTTTGCAGGTCTTGGG - Intergenic
1053347999 9:37392278-37392300 CCCAGTAGCTTAGGGGTCACTGG + Intergenic
1058726164 9:107806578-107806600 ACAAGGAACTTGGAGGTCCTTGG - Intergenic
1059099560 9:111456806-111456828 CGTAAGAGCTTGGTGGTCATGGG + Intronic
1059335514 9:113566272-113566294 CCCATGGGGTTGGAGGTCAGAGG - Intronic
1062065611 9:134524709-134524731 CCCAGGGGATGGGAGGGCATGGG - Intergenic
1185936059 X:4258009-4258031 CCCAGAAGCTTGGAGGTGCCAGG - Intergenic
1187310086 X:18133372-18133394 TCCAGGAACTTTGAGGGCATTGG + Intergenic
1187699218 X:21948651-21948673 CCCAGAAGATTGGAGATTATGGG + Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1191768891 X:64733409-64733431 CCCAGGAACTTGGTAGTCTTAGG + Intergenic
1192209781 X:69120494-69120516 GGCAGGAGGATGGAGGTCATAGG - Intergenic
1197424062 X:126273239-126273261 CCCAGGAACTCGAAGGTCTTAGG + Intergenic
1198679848 X:139169864-139169886 CCCAGCAGCATGGAGGGCAAAGG + Intronic
1199245632 X:145600290-145600312 CCCAGGAGCTTGGCAGTCCTGGG - Intergenic
1200523855 Y:4247374-4247396 CCCAGGAACTTGGTAGTCTTAGG - Intergenic