ID: 1140728963

View in Genome Browser
Species Human (GRCh38)
Location 16:77838925-77838947
Sequence AGCCCTGGGGGTAACTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 188}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140728952_1140728963 17 Left 1140728952 16:77838885-77838907 CCCCACCCCCATCTCTTTCTTTC 0: 1
1: 2
2: 20
3: 269
4: 2053
Right 1140728963 16:77838925-77838947 AGCCCTGGGGGTAACTGTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1140728951_1140728963 18 Left 1140728951 16:77838884-77838906 CCCCCACCCCCATCTCTTTCTTT 0: 1
1: 2
2: 30
3: 404
4: 4847
Right 1140728963 16:77838925-77838947 AGCCCTGGGGGTAACTGTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1140728957_1140728963 10 Left 1140728957 16:77838892-77838914 CCCATCTCTTTCTTTCAGCATCT 0: 1
1: 0
2: 2
3: 58
4: 627
Right 1140728963 16:77838925-77838947 AGCCCTGGGGGTAACTGTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1140728949_1140728963 22 Left 1140728949 16:77838880-77838902 CCACCCCCCACCCCCATCTCTTT 0: 1
1: 9
2: 54
3: 465
4: 2919
Right 1140728963 16:77838925-77838947 AGCCCTGGGGGTAACTGTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1140728955_1140728963 12 Left 1140728955 16:77838890-77838912 CCCCCATCTCTTTCTTTCAGCAT 0: 1
1: 0
2: 1
3: 48
4: 630
Right 1140728963 16:77838925-77838947 AGCCCTGGGGGTAACTGTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1140728953_1140728963 16 Left 1140728953 16:77838886-77838908 CCCACCCCCATCTCTTTCTTTCA 0: 1
1: 0
2: 7
3: 114
4: 1124
Right 1140728963 16:77838925-77838947 AGCCCTGGGGGTAACTGTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1140728956_1140728963 11 Left 1140728956 16:77838891-77838913 CCCCATCTCTTTCTTTCAGCATC 0: 1
1: 1
2: 4
3: 52
4: 556
Right 1140728963 16:77838925-77838947 AGCCCTGGGGGTAACTGTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1140728950_1140728963 19 Left 1140728950 16:77838883-77838905 CCCCCCACCCCCATCTCTTTCTT 0: 1
1: 1
2: 29
3: 265
4: 1968
Right 1140728963 16:77838925-77838947 AGCCCTGGGGGTAACTGTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1140728954_1140728963 15 Left 1140728954 16:77838887-77838909 CCACCCCCATCTCTTTCTTTCAG 0: 1
1: 1
2: 5
3: 90
4: 930
Right 1140728963 16:77838925-77838947 AGCCCTGGGGGTAACTGTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 188
1140728958_1140728963 9 Left 1140728958 16:77838893-77838915 CCATCTCTTTCTTTCAGCATCTG 0: 1
1: 0
2: 4
3: 64
4: 740
Right 1140728963 16:77838925-77838947 AGCCCTGGGGGTAACTGTGTTGG 0: 1
1: 0
2: 1
3: 10
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140728963 Original CRISPR AGCCCTGGGGGTAACTGTGT TGG Intronic
900119592 1:1042839-1042861 AGCCCTGGGTGTGACTCTGGGGG + Intronic
900307013 1:2015433-2015455 AGCCCTGGGAGTCACTGACTCGG - Intergenic
901261710 1:7876138-7876160 AGCCCTGGGGATGTTTGTGTGGG - Intergenic
902073308 1:13761287-13761309 AGCCCTGAAAGTAATTGTGTGGG + Intronic
902282457 1:15384425-15384447 AGCCCTGGGGGACACTGCCTCGG - Intronic
903295217 1:22339337-22339359 AGCCCTGTGGGTGACTGGGCAGG - Intergenic
904029318 1:27524043-27524065 AACCCTGGGGGCAGCTGGGTTGG + Intergenic
905270412 1:36783852-36783874 AGCCCTAGGGGAAACTGTAGAGG - Intergenic
905386094 1:37605417-37605439 AGCCCTGGAGGTAGCTGGGCAGG + Intergenic
906514996 1:46433641-46433663 AGCCCTGGGGTTGACTCTGGAGG + Intergenic
907278491 1:53329686-53329708 AGCAATGGGGGTAACTGTAGAGG + Intergenic
911836324 1:102623596-102623618 AGCCCTGAGGTTAAATGTATAGG - Intergenic
912361838 1:109101655-109101677 AGCCCTGGGGATACAAGTGTTGG - Intergenic
913335293 1:117704041-117704063 AGCCCTGGGCCTGCCTGTGTAGG + Intergenic
917793915 1:178518925-178518947 ACCACTGGGGGAAACTGTGAGGG + Intronic
920654243 1:207863850-207863872 AGCCTCTGGGGAAACTGTGTCGG + Intergenic
922776725 1:228217746-228217768 AGCCCTGGGGGACACAGTGCAGG - Intronic
924846221 1:247775124-247775146 AGCCCTGGGTGCAATTGTGGAGG - Intergenic
1062821479 10:537524-537546 TGCCCTGGGGACAAATGTGTGGG - Intronic
1063200054 10:3779415-3779437 GGCCCTGGAGGCAACTGGGTAGG + Exonic
1065257490 10:23886054-23886076 AGCTCTGGGTGTGATTGTGTGGG + Intronic
1066256112 10:33680246-33680268 GGCTCTGGTGGTGACTGTGTTGG - Intergenic
1066347640 10:34604244-34604266 AACCCTGGGTGTGTCTGTGTGGG + Intronic
1067089490 10:43259340-43259362 AGCCCTGGGGGAGTCTGGGTAGG - Intronic
1067266599 10:44750957-44750979 ACCACTGGGGGAAACTGTGGGGG + Intergenic
1067274557 10:44822105-44822127 AGCCCTGGGGGCAGCCCTGTGGG - Intergenic
1067296751 10:44979064-44979086 GGCCCTGGGGCTACCTGTGAGGG - Intronic
1069634487 10:69917135-69917157 TGCCCTGGTGGCAGCTGTGTGGG - Intronic
1070754352 10:78982336-78982358 GGCCCTGGGGTCAAATGTGTAGG - Intergenic
1073346419 10:102786287-102786309 ACTCTTGTGGGTAACTGTGTTGG + Intronic
1075906470 10:126085990-126086012 AGCCATGGGGGTAAGTGTGTGGG + Intronic
1077530553 11:3092830-3092852 AGCCCTGGGGGCCACAGGGTGGG - Intronic
1080486412 11:32712119-32712141 AGCACTGGGTGGAAATGTGTGGG - Intronic
1082807995 11:57462053-57462075 GGCCCTGGGGGTGGCTGTGAGGG + Intronic
1083079588 11:60076747-60076769 AGCCATAGGGAAAACTGTGTGGG + Intergenic
1083472795 11:62895426-62895448 AGCCCTGGGGGTAGAGGTGGGGG + Intergenic
1086953932 11:92916556-92916578 AGCCCTGTGGTTAACAATGTAGG + Intergenic
1087234179 11:95699997-95700019 AGCCCCAGAGGAAACTGTGTGGG - Intergenic
1090427157 11:126615947-126615969 AGCCCTGGGTGTGTGTGTGTGGG + Intronic
1091573349 12:1710747-1710769 AGCCATGAGGGGAACTCTGTAGG + Intronic
1092254543 12:6919131-6919153 TGCCTTGGGGGAAACTGTATAGG + Intronic
1095211432 12:39499420-39499442 AGCAATGGGGGTGAGTGTGTTGG - Intergenic
1095750000 12:45699218-45699240 TGCCCTTGGGGAAACTGGGTGGG + Intergenic
1097508558 12:60507222-60507244 ACCCCTGTGGGTAACTCTCTAGG - Intergenic
1097981170 12:65739296-65739318 TGCCCTGGGGGTAAAAGTTTTGG + Intergenic
1102229595 12:111253274-111253296 AGCCCTGGGGGTCACTGCGAGGG - Intronic
1108875036 13:55036724-55036746 AGCCTTGGGTGTGTCTGTGTGGG + Intergenic
1113958490 13:114112385-114112407 AGCTCTGCGGGTGACTGTTTGGG + Intronic
1115106340 14:29765937-29765959 AGACCTGGGGGTGACTGCATGGG + Intronic
1116503755 14:45652559-45652581 AATCCTGGGTGTATCTGTGTGGG + Intergenic
1121201724 14:92123038-92123060 AGCCCTGGAGCTCACTGAGTGGG - Intronic
1121426960 14:93859206-93859228 ATCCCTGGTGGTAGCTGTGGTGG - Intergenic
1121839076 14:97117840-97117862 ACCCCTGGGGGTAGCTGTTGAGG - Intergenic
1128463361 15:67888240-67888262 AGCCATGGGAGGAACTGTGGGGG + Intergenic
1128758666 15:70199891-70199913 AGCCCTGGGGGAAAGTGGGGAGG - Intergenic
1129949475 15:79573296-79573318 AGCCCTGGGGGCAGCTGGCTGGG + Intergenic
1132181259 15:99754412-99754434 AGAGCTGGGGGGATCTGTGTAGG - Intergenic
1134023976 16:10941095-10941117 GGCCCTTGGGGTAGCTGGGTGGG - Intronic
1134859664 16:17549945-17549967 AACCCTGGGTGTGTCTGTGTGGG + Intergenic
1137722395 16:50635125-50635147 AACCCTGGGGCTAGCAGTGTGGG + Exonic
1138282731 16:55784362-55784384 AGGTTTGGGGGTAACTGTGCAGG - Intergenic
1138286211 16:55812258-55812280 AGGTTTGGGGGTAACTGTGCAGG + Intronic
1140271929 16:73473794-73473816 AGCCCATAGGGAAACTGTGTGGG + Intergenic
1140718567 16:77749520-77749542 AGTCATGGGGGCAACTGTGGTGG - Intergenic
1140728963 16:77838925-77838947 AGCCCTGGGGGTAACTGTGTTGG + Intronic
1142293056 16:89201483-89201505 AGCGCTGGGGGCAACAGCGTGGG + Exonic
1142420048 16:89964447-89964469 ACCGCTGGGGGGAACAGTGTGGG - Exonic
1144968490 17:19092589-19092611 AGCCCTGGGGGTGGGTGGGTGGG + Intergenic
1144979427 17:19159474-19159496 AGCCCTGGGGGTGGGTGGGTGGG - Intergenic
1144988795 17:19218758-19218780 AGCCCTGGGGGTGGGTGGGTGGG + Intronic
1146324497 17:31874130-31874152 AGCTGTGGGTCTAACTGTGTGGG - Intronic
1147994123 17:44352035-44352057 AGCCCTGGGGGCAGCAGTGCTGG - Exonic
1151656678 17:75499493-75499515 AGCCCTGGGGCTCACTGTGGAGG + Exonic
1151661061 17:75518344-75518366 AGCCCTGGGGCTCTCTGTGTAGG + Intronic
1153089600 18:1329321-1329343 AACCCTGGGTGTGTCTGTGTGGG + Intergenic
1155656642 18:28200871-28200893 AGCCTTTAGGGAAACTGTGTTGG + Intergenic
1155818204 18:30343101-30343123 AGCCCAGGGGGGAACTAGGTGGG + Intergenic
1157697565 18:49735061-49735083 AGCCCTCGTGGTAACTATGAGGG + Intergenic
1159095332 18:63895289-63895311 AGTCATGGGGGTAACTGCATTGG - Exonic
1159954972 18:74512781-74512803 GGACCTGGGGGTGACTGAGTTGG - Intronic
1160840462 19:1144435-1144457 AGCCCTCGGGGCCACTGTGCTGG - Intronic
1161907758 19:7169933-7169955 CCCCCTGGGGGTGACTGTGATGG + Intronic
1161991258 19:7685701-7685723 AGCCCTGGGGCTATGTGTGGTGG - Exonic
1162787289 19:13043667-13043689 GGCCCTGGGGGACACTGTCTGGG - Intronic
1165311094 19:35030050-35030072 AGGCCTGGGGGTCAATGTGCAGG - Intergenic
926226563 2:10971193-10971215 AGCCCTGGGGTAAACTTTCTGGG + Intergenic
926475313 2:13314587-13314609 AACCCTGGGGGTTGGTGTGTGGG - Intergenic
931216783 2:60252571-60252593 GGCTCTGGGGGAAAATGTGTGGG - Intergenic
931416720 2:62088584-62088606 AGCCATGGGAGTAAATGGGTAGG - Intronic
932310111 2:70732914-70732936 ATGCCTGGGGGAAACAGTGTAGG + Intronic
932992429 2:76804063-76804085 AGCACTCGGAGTAACTTTGTAGG - Intronic
934758314 2:96839641-96839663 AGGCCTGGGAGCAACGGTGTGGG + Exonic
934976805 2:98808608-98808630 AGCCCTGGGGGTAGATGTCCTGG - Intronic
938359021 2:130673871-130673893 AGCATTGGGGGTGATTGTGTTGG + Intergenic
942428116 2:175880638-175880660 AGCCCTGGGGCGAAATGTGTTGG + Intergenic
945658373 2:212653925-212653947 AGGTCCGGGGGTAGCTGTGTAGG + Intergenic
947841209 2:233208958-233208980 AGCCCTGGGTTTGACTGTGGTGG - Intergenic
948063071 2:235056210-235056232 AGCCCTGGGGACCAGTGTGTCGG + Intergenic
948867102 2:240781749-240781771 GCCCCTGTGGGGAACTGTGTGGG - Intronic
1169422570 20:5471773-5471795 AGCCCTGGGGTTACCTGTCAAGG - Intergenic
1169426898 20:5504009-5504031 AGCCCTGGGGTTACCTGTCAAGG + Intergenic
1170004019 20:11646557-11646579 TGCCCTGGGGGCCACTGTGATGG + Intergenic
1170810561 20:19670875-19670897 AGACCTGGGGGTGTCTGCGTGGG + Intronic
1170847097 20:19971481-19971503 TGCCTTGGGGGAATCTGTGTGGG + Intronic
1171414569 20:24968977-24968999 AGCTCTGGGGGGTACTGGGTGGG - Exonic
1172568967 20:35954175-35954197 GCCCCTGAGCGTAACTGTGTGGG - Exonic
1175012502 20:55754019-55754041 AGCCCTGTAAGAAACTGTGTAGG + Intergenic
1175355129 20:58359396-58359418 AGCACTGGGGGAAACTGGGTGGG + Intronic
1175888283 20:62304365-62304387 AGCCCTGGGTCTAACCGGGTGGG - Intronic
1176366432 21:6035694-6035716 AGCCCTGGGGCTTGCTGTGCTGG + Intergenic
1178732586 21:35118174-35118196 AGCACTGGTTTTAACTGTGTGGG + Intronic
1179047941 21:37863304-37863326 AGCCATTGGGGCTACTGTGTTGG - Intronic
1179757085 21:43502851-43502873 AGCCCTGGGGCTTGCTGTGCTGG - Intergenic
1180852643 22:19029372-19029394 AGCCCTGGGGGTTCCGGTCTGGG - Intergenic
1181694243 22:24585040-24585062 GGCCCTGGGGGTCCCCGTGTGGG - Intronic
1183436208 22:37796990-37797012 AACTGTGTGGGTAACTGTGTGGG - Intergenic
950648652 3:14393557-14393579 AGCCTTGGGGGCAGATGTGTGGG - Intergenic
952605532 3:35142986-35143008 AATCCTGGGTGTATCTGTGTGGG - Intergenic
953676839 3:45009325-45009347 AGCCTTGGGGGTAGTTGTGCAGG + Intronic
954504737 3:51058946-51058968 AGATCTGGGGGTACATGTGTAGG + Intronic
957963815 3:87295690-87295712 AGGCCTGGTGGTAAGTGTTTGGG - Intergenic
960137868 3:114123859-114123881 AGCTCTGAGAGTAAGTGTGTGGG + Intergenic
961295723 3:125882696-125882718 AACCCGGGGGGTCACTTTGTAGG + Intergenic
965699038 3:171440487-171440509 AGCTCTAGGGGTAACAGTGGAGG + Intronic
967309083 3:188089200-188089222 AGCCCTGCTGGTGACAGTGTAGG + Intergenic
968817784 4:2830719-2830741 AGCCATTGGCGTAACTCTGTGGG - Intronic
968982658 4:3858858-3858880 AGCACTGGGGGTCACTGTTGAGG + Intergenic
970323940 4:14903677-14903699 AGACCTGGGGGTGGCTGTGGAGG - Intergenic
973797736 4:54445761-54445783 AGCCCTTGGGGTAATGTTGTGGG - Intergenic
975005185 4:69274772-69274794 TGCTCTGGTGGTGACTGTGTGGG - Intergenic
975913510 4:79297258-79297280 TGCCCTGGGGGCTACTGTGATGG + Intronic
978507100 4:109470517-109470539 AGCCCTGGGGACAGCTCTGTAGG - Intronic
979507540 4:121515014-121515036 TGCCCTGGTGGGGACTGTGTGGG - Intergenic
985928477 5:3035963-3035985 AGCCCTGGGAGTAACTGGCCAGG - Intergenic
986397935 5:7348771-7348793 AGCCCTGGGGGAACCTCTGTGGG + Intergenic
988858323 5:35251269-35251291 AACCCTGGGTGTGTCTGTGTGGG + Intergenic
990110916 5:52323410-52323432 AGCCCTGGGGCTAGGAGTGTGGG - Intergenic
995660167 5:114473068-114473090 AGCCCTGGTGGTAGCTGTAGTGG + Exonic
996937551 5:128965841-128965863 ACCCCTGAGGGTGGCTGTGTTGG + Exonic
997281865 5:132654068-132654090 ATCTCTGAGGGTAATTGTGTGGG - Intergenic
1000448435 5:161354164-161354186 AGTCCTGGGTCTAACTGTGTAGG + Intronic
1000911677 5:167030448-167030470 AGCGCTGGGGGTAACGGGGCAGG - Intergenic
1002188781 5:177468309-177468331 ACCCCTGGGGGTGCCTGTGGAGG - Intronic
1003307694 6:4944575-4944597 GGCCCTGGGGTGAACTGTGGTGG - Intronic
1003889726 6:10553395-10553417 AGACCTGGGGAAAACTGTGTTGG - Intronic
1004006179 6:11639141-11639163 ATCCCTGAGTGTATCTGTGTTGG - Intergenic
1007787042 6:44286552-44286574 AGCGCAGGGGGTCACAGTGTTGG + Intronic
1014295648 6:119614149-119614171 AGCCATGGAGGTACCAGTGTAGG - Intergenic
1015570091 6:134611961-134611983 AACCCTGGGTGTGTCTGTGTGGG + Intergenic
1018143288 6:160860960-160860982 AGCACTGAGAGTAAATGTGTAGG - Intergenic
1018316019 6:162557360-162557382 TGCCCTGGGGGGAATGGTGTTGG - Intronic
1018815807 6:167329999-167330021 AGCACTGAGGGTAAAAGTGTAGG + Intronic
1019329692 7:456186-456208 AGGCCTGGGGGTCCCAGTGTTGG - Intergenic
1019329748 7:456329-456351 AGGCCTGGGGGTCCCAGTGTTGG - Intergenic
1019329829 7:456543-456565 AGGCCTGGGGGTCCCAGTGTTGG - Intergenic
1019329885 7:456685-456707 AGGCCTGGGGGTCCCAGTGTTGG - Intergenic
1019329940 7:456827-456849 AGGCCTGGGGGTCCCAGTGTTGG - Intergenic
1019329967 7:456898-456920 AGGCCTGGGGGTCCCAGTGTTGG - Intergenic
1019390970 7:786860-786882 AGCCTTGGGGGTGTCTGGGTAGG + Intergenic
1034063801 7:148117671-148117693 AGCCCCTGGGGTTACTCTGTGGG - Intronic
1035865568 8:3077707-3077729 AGCTCTGGGGGAAAATGTGTAGG - Intronic
1037985323 8:23287443-23287465 AGCCTTGTGGGTTACTGGGTTGG - Intronic
1040286193 8:46101618-46101640 AGCCCTGGGGGTTTCTGGGATGG + Intergenic
1040291803 8:46129393-46129415 AGCCCTGGGGGCTTCTGTGATGG + Intergenic
1040292834 8:46134204-46134226 AGCCCTGGGGGTGGCTGGGATGG + Intergenic
1040294582 8:46142619-46142641 AGCCCTGGGGGCTTCTGTGATGG + Intergenic
1040299306 8:46179745-46179767 AGCCCTGGGGGCTTCTGGGTTGG + Intergenic
1040306829 8:46216355-46216377 AGCCCTGGGGGTTTCTGGGATGG - Intergenic
1040308757 8:46225761-46225783 AGCCCTGGGGGCTTCTGGGTTGG - Intergenic
1040311330 8:46238341-46238363 AGCCCTAGGGGTTTCTGTGATGG - Intergenic
1040313468 8:46248830-46248852 AGCCCTGGGGGTTTCTGGGATGG - Intergenic
1040313984 8:46251298-46251320 AGCCCTGGGGGTTTCTGGGATGG - Intergenic
1040314794 8:46255232-46255254 AGCCCTGGGGGCTTCTGTGATGG - Intergenic
1040315122 8:46256961-46256983 AGCCCTGGGGGCTTCTGTGATGG - Intergenic
1040333758 8:46405717-46405739 AGCCCTGGGGGTTTCTGGGATGG - Intergenic
1040334008 8:46406971-46406993 AGCCCTGGGGGTTTCTGGGATGG - Intergenic
1040337199 8:46422072-46422094 AGCCCTGGGGGCTTCTGTGATGG - Intergenic
1041111472 8:54487029-54487051 AGCACTGGGGGCATCTGTGAGGG - Intergenic
1046307394 8:112387013-112387035 AGCCATGGGGGAAAATATGTTGG - Intronic
1049724446 8:144138990-144139012 AGCCCTAGGGGTGAGTGTGTGGG - Exonic
1049855754 8:144860819-144860841 AGCCCTGTGTGTGACGGTGTGGG + Intergenic
1052114243 9:24629702-24629724 AGGCTTGGGGGTAAATGTGAAGG - Intergenic
1056809155 9:89750841-89750863 AGAGCTGTCGGTAACTGTGTTGG + Intergenic
1057473604 9:95380250-95380272 ATCACTGGGGGTAACTATCTTGG - Intergenic
1057522888 9:95773904-95773926 AACCCTTGTGGTAACTGTGATGG - Intergenic
1058651803 9:107181890-107181912 AGCCCTCTGGGTAAATGTGGTGG - Intergenic
1060419236 9:123455622-123455644 AGCCCTGGGGGTTCCTGTTCTGG - Intronic
1186769512 X:12803896-12803918 AGCTCTATGGATAACTGTGTTGG + Intronic
1191767591 X:64715252-64715274 AGGCTTGGGGGTAAATGTGAAGG - Intergenic
1194014776 X:88605528-88605550 ACCCCTGGGAGTAACAGGGTGGG - Intergenic
1194206440 X:91016705-91016727 AGCCCTGGATGTGTCTGTGTGGG + Intergenic
1194646280 X:96462697-96462719 AGCCCTGGGTGTTTCTGTGAGGG + Intergenic
1196090514 X:111736383-111736405 AGCCCAGAGGTTAACTGTTTGGG + Intronic
1199033505 X:143027525-143027547 AGCCCTGTGTGTGACAGTGTGGG + Intronic
1199093941 X:143719144-143719166 AGCCCTGTGTGTGACGGTGTGGG - Intronic
1199312997 X:146343571-146343593 AGCCTTGGGGGCAATTGTGAAGG + Intergenic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic
1200552192 Y:4591526-4591548 AGCCCTGGATGTGTCTGTGTGGG + Intergenic
1201293378 Y:12443186-12443208 AGCACTGGGAGGAGCTGTGTGGG - Intergenic
1202024198 Y:20502811-20502833 ATCCCTGGTAGCAACTGTGTAGG - Intergenic