ID: 1140731505

View in Genome Browser
Species Human (GRCh38)
Location 16:77860693-77860715
Sequence GAGGACTATCTTTTCTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140731505_1140731510 6 Left 1140731505 16:77860693-77860715 CCTCCCTAGAAAAGATAGTCCTC 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1140731510 16:77860722-77860744 CTTTATAAAATCTAGAAGGCAGG 0: 1
1: 1
2: 4
3: 22
4: 310
1140731505_1140731509 2 Left 1140731505 16:77860693-77860715 CCTCCCTAGAAAAGATAGTCCTC 0: 1
1: 0
2: 0
3: 7
4: 94
Right 1140731509 16:77860718-77860740 TTTGCTTTATAAAATCTAGAAGG 0: 1
1: 0
2: 9
3: 37
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140731505 Original CRISPR GAGGACTATCTTTTCTAGGG AGG (reversed) Intronic
905159976 1:36024015-36024037 GAGCACTATGATTTCAAGGGAGG - Intronic
906096597 1:43228375-43228397 GAAGCCTATTTTGTCTAGGGCGG - Intronic
906940790 1:50253302-50253324 AAAGACTCTCTTTTCTTGGGTGG + Intergenic
908721537 1:67131557-67131579 CTGGACTATCTTTTCTTGGATGG - Intronic
910411217 1:86947204-86947226 TCAGACTATCTTTTCAAGGGTGG - Intronic
912996858 1:114539135-114539157 GAGGTCTTTATTTTCTAGAGAGG + Intergenic
918964373 1:191322492-191322514 GAGAAATTTCTTTTCTAGGGTGG - Intergenic
923014631 1:230116968-230116990 TAGGACTATCATTGCTAGGGAGG - Intronic
1067262369 10:44705486-44705508 GAGGAGTATGTTTTGTAAGGTGG + Intergenic
1070810536 10:79295516-79295538 GAGGACTCTCTTCTCTAGCTTGG + Intronic
1071797939 10:89026055-89026077 ATGGACTTTCTTTTCCAGGGTGG + Intergenic
1075032742 10:119037066-119037088 GAGAACTGTCGTTTCTGGGGGGG - Intronic
1077789804 11:5426238-5426260 GAGGATTTTATTTTTTAGGGTGG + Intronic
1080647392 11:34196979-34197001 GAGCACTAACCTTTCTAGGTGGG + Intronic
1083953872 11:65971691-65971713 GAGGATTGGGTTTTCTAGGGAGG + Intronic
1089212780 11:116817250-116817272 GTGGAGAATCTTTTCTGGGGTGG - Intergenic
1093739504 12:22666997-22667019 GTAAACTATGTTTTCTAGGGTGG + Intronic
1096081042 12:48832699-48832721 GAGGACACTATTTTCTAAGGTGG - Intronic
1098216858 12:68229947-68229969 GGGGCCTATCTTTTCTGGAGAGG - Intergenic
1101589520 12:106113385-106113407 GAGCACTATCTGTCCAAGGGTGG + Intronic
1102606103 12:114068550-114068572 GTGGAATGGCTTTTCTAGGGAGG - Intergenic
1107545247 13:41428289-41428311 GAGGACCGTCGTATCTAGGGTGG + Intergenic
1111505850 13:89186578-89186600 AAGGAGTATCTTTCCTAAGGGGG + Intergenic
1113072386 13:106434288-106434310 TAGAACTATCTTTTGTTGGGTGG - Intergenic
1113525232 13:110969411-110969433 GTGGAATGGCTTTTCTAGGGAGG - Intergenic
1114405182 14:22449867-22449889 GAGGACCATATTTCCTATGGCGG - Intergenic
1116078563 14:40144174-40144196 CAGTACTATCTTTTAGAGGGGGG - Intergenic
1119060445 14:71468975-71468997 GAGTACTTGCTTTTCTAGTGTGG - Intronic
1120963423 14:90146314-90146336 GTGGAATATCTTTTTTAGTGGGG + Intronic
1125477689 15:40058526-40058548 GAGGACAATCTTCTCTGAGGAGG + Intergenic
1125690037 15:41588640-41588662 GTGGAATGGCTTTTCTAGGGAGG - Intergenic
1133851962 16:9513574-9513596 GAGGACTATTGATTCTATGGAGG + Intergenic
1134644051 16:15852234-15852256 GAAGACAATATTTTCCAGGGTGG - Intronic
1136546892 16:30959621-30959643 GAAGAATATCTTGTCTAGGGTGG - Intronic
1140731505 16:77860693-77860715 GAGGACTATCTTTTCTAGGGAGG - Intronic
1141998487 16:87649549-87649571 CAGGACTTTCTTCTCTAGGATGG - Intronic
1155522524 18:26683325-26683347 GAGGACTGTCCTTTCCAGTGTGG + Intergenic
1156739072 18:40301805-40301827 GAGATCTATCTTTTCGATGGAGG + Intergenic
1157857951 18:51118419-51118441 GAGGACTATCATTAATAGGAAGG + Intergenic
1159188130 18:65005795-65005817 GAGGAGTAACTAATCTAGGGGGG - Intergenic
1162421358 19:10567786-10567808 GAGGACTATCAATTCTTTGGGGG - Intronic
1162592559 19:11602060-11602082 AAGGATTTTCTTTTGTAGGGAGG + Intronic
1163884500 19:19953878-19953900 AAGGGCTTTCTTTCCTAGGGAGG - Intergenic
1163915014 19:20233544-20233566 AAGAGCTTTCTTTTCTAGGGAGG - Intergenic
1163933647 19:20422513-20422535 AAGGACTTTCTTTCCTAAGGAGG - Intergenic
1163939877 19:20481775-20481797 AAGGGCTTTCTTTCCTAGGGAGG + Intergenic
1163948522 19:20562976-20562998 AAGGGCTTTCTTTTTTAGGGAGG - Intronic
1163959010 19:20669781-20669803 AAGGACTTTCTTCCCTAGGGAGG + Intronic
1164005616 19:21145808-21145830 AAGGGCTTTCTTTCCTAGGGAGG + Intronic
928874307 2:36018924-36018946 GCTGAATATCTTTTCAAGGGGGG - Intergenic
929119761 2:38475019-38475041 GAGGACAATTTTTTCTTGGCAGG - Intergenic
929154495 2:38777303-38777325 TAGGACTATTGTATCTAGGGTGG + Intronic
929562569 2:42964874-42964896 TAGCACTGGCTTTTCTAGGGAGG + Intergenic
933389738 2:81654459-81654481 GTGGAATGGCTTTTCTAGGGAGG + Intergenic
942919724 2:181357553-181357575 TAGGAGAATCTTTTCTAGGAAGG + Intergenic
943133690 2:183887510-183887532 GAGGATTATCTTTAATAGGAAGG - Intergenic
947235343 2:227935679-227935701 GAAGCCTATCTTTTCCAGTGTGG - Intergenic
1168823907 20:795958-795980 GTGGAATGGCTTTTCTAGGGAGG - Intergenic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1177293466 21:19145773-19145795 CAGTACTATCACTTCTAGGGAGG + Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1183010531 22:34943118-34943140 TAGGGCTTTCTTTTCTAGGGAGG + Intergenic
1185381587 22:50510777-50510799 GAGGACTATTTTAGATAGGGTGG - Intronic
950846423 3:16020136-16020158 GTGGAATGGCTTTTCTAGGGAGG + Intergenic
952045673 3:29316392-29316414 GAGTGTTATCTTTGCTAGGGAGG - Intronic
952157928 3:30663963-30663985 GAGGGCTAACTTTTTTGGGGGGG + Intronic
956900304 3:73708492-73708514 GAGGACTATGCATTCTATGGTGG - Intergenic
967833506 3:193942264-193942286 GAGGACTATTTTTTGTAGCGGGG - Intergenic
971381772 4:26105562-26105584 GTGGACTCTGTTTTCTAGTGAGG + Intergenic
975194601 4:71509384-71509406 ATGGAGTATCTTTTGTAGGGAGG + Intronic
976787680 4:88840369-88840391 GAGGAATATGGTTTCTAGAGAGG + Intronic
986152778 5:5142519-5142541 GAGGAGGATCTTTTCTCTGGTGG - Intronic
989613815 5:43319792-43319814 GTGGAATGGCTTTTCTAGGGAGG + Intergenic
990822925 5:59862991-59863013 AAGCAGTATATTTTCTAGGGAGG + Intronic
993994339 5:94703232-94703254 GAAAACTATCTTTTCTCTGGAGG - Intronic
996423366 5:123286017-123286039 GAAGACTCTTTTTTCAAGGGAGG + Intergenic
997756982 5:136408597-136408619 GAAGAATATCTTTTATAGGTAGG + Intergenic
1000962018 5:167611366-167611388 CAGGACTGTATATTCTAGGGAGG - Intronic
1005230577 6:23697297-23697319 GAGGACTATCATTTATAGCAGGG + Intergenic
1006624228 6:35385929-35385951 GAGGATCATCATTTCAAGGGCGG + Intronic
1010166205 6:72917916-72917938 CAGGTGTTTCTTTTCTAGGGGGG + Intronic
1010363900 6:75027540-75027562 GAGAACTATAATTTTTAGGGAGG + Intergenic
1011500073 6:87978595-87978617 GAGGAATATGTTTTTTAGGGAGG - Intergenic
1011767861 6:90643344-90643366 GAGTACTAGATTTTCAAGGGGGG - Intergenic
1018987055 6:168645773-168645795 GAGGACAGTCTTTTCTCAGGTGG + Intronic
1029812485 7:103063581-103063603 GAGGGCTTTATTTTCTAGAGTGG - Intronic
1031403548 7:121355142-121355164 CATGACTATCTTTTACAGGGAGG + Intronic
1031948342 7:127864917-127864939 GAGGACCAATTTTTATAGGGTGG + Intronic
1036179981 8:6576266-6576288 GAGGACCTTCTTTTATAGGGTGG - Intronic
1036191494 8:6674721-6674743 GAGGACTCTCTTTTTCAGGATGG + Intergenic
1044139314 8:88629934-88629956 AAGGAATATCTTTTCTACAGAGG - Intergenic
1047918544 8:129608691-129608713 GAGGACTATATTCCCTTGGGGGG - Intergenic
1053435571 9:38071668-38071690 GAGGACTTTCTTGTCTCAGGTGG - Intergenic
1056414667 9:86364882-86364904 GTGGAATGGCTTTTCTAGGGAGG + Intergenic
1056874067 9:90311252-90311274 GAAGAATATCATTTCTAGGCCGG + Intergenic
1058377132 9:104335828-104335850 GGGGACTATATCTTCTAAGGTGG - Intergenic
1061595850 9:131628634-131628656 GCCGACTGTCTTTTCTTGGGTGG + Exonic
1062115208 9:134804995-134805017 GAGGGCCATCTTTCCCAGGGAGG - Exonic
1186229227 X:7435272-7435294 TAGAAATATCTTTTCTGGGGAGG + Intergenic
1194432432 X:93826011-93826033 GAAGAATATCTTTTATAGTGAGG - Intergenic
1196536222 X:116847887-116847909 GAGGACTATATATGCTGGGGGGG - Intergenic
1201961232 Y:19682583-19682605 GAGGACTCTCCTTTCTGGGTGGG - Intergenic