ID: 1140732456

View in Genome Browser
Species Human (GRCh38)
Location 16:77869126-77869148
Sequence AATGAGTAGCAGAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 608
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 555}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140732451_1140732456 -10 Left 1140732451 16:77869113-77869135 CCAAAATCAGGAGAATGAGTAGC 0: 1
1: 0
2: 1
3: 11
4: 162
Right 1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG 0: 1
1: 0
2: 4
3: 48
4: 555
1140732449_1140732456 21 Left 1140732449 16:77869082-77869104 CCATGTACAGGAATGGTGAGAGA 0: 1
1: 0
2: 1
3: 15
4: 169
Right 1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG 0: 1
1: 0
2: 4
3: 48
4: 555

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140732456 Original CRISPR AATGAGTAGCAGAAGGGGGA AGG Intronic
900007579 1:73168-73190 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
900687591 1:3958528-3958550 AATGAATAGCACAGGGTGGAAGG - Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
900883513 1:5399357-5399379 AATGAGTGGAAGGATGGGGATGG + Intergenic
900974902 1:6010878-6010900 AATGAGTGGCAGGAGGTGCATGG + Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
904010052 1:27384075-27384097 TAGGAGAAGCAGATGGGGGAAGG - Intergenic
904120322 1:28193924-28193946 AATGAGCAGCAGCAGGATGAAGG + Intronic
905121934 1:35688989-35689011 AAAGAGAAAGAGAAGGGGGATGG + Intergenic
905313073 1:37064091-37064113 AGAGAGGAGCAGAAGGGCGAGGG + Intergenic
905589354 1:39149085-39149107 AATGAGGATCAGAAGGGAGAGGG + Intronic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906191961 1:43904724-43904746 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906192145 1:43905391-43905413 GAAGAGGAGCAGAAGGGGGAGGG - Intronic
906192324 1:43906042-43906064 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906730867 1:48080034-48080056 AATGACCACCAGAAGAGGGAGGG + Intergenic
907462145 1:54611499-54611521 AAGGGATATCAGAAGGGGGAAGG - Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
908353157 1:63306225-63306247 AATAAGGAGGAGAAGGAGGAAGG + Intergenic
908373436 1:63506776-63506798 AATATGTTGCTGAAGGGGGAAGG - Intronic
908528262 1:65008664-65008686 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
909532971 1:76701432-76701454 GATGAGTAGGAGCTGGGGGAAGG + Intergenic
909547352 1:76862662-76862684 AATGAGTATCACAAGTGGAATGG - Intergenic
909686546 1:78355211-78355233 AAGGAGGAGGAGAAAGGGGAGGG - Intronic
909991035 1:82222716-82222738 AATGAGGAGCAGAATGGAGCTGG - Intergenic
911323566 1:96443181-96443203 AATGAGGAGGAGGAGGAGGAGGG - Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
914121095 1:144783192-144783214 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
914751189 1:150536183-150536205 AATGAGCAGGAGATGAGGGATGG + Intergenic
915038218 1:152946472-152946494 AATGATTATCATAAGGTGGAGGG - Intergenic
915271434 1:154756452-154756474 ACTGAGCCGCAGAAGGGGGCAGG - Intronic
915608595 1:156971826-156971848 GGTGAGGAGGAGAAGGGGGAGGG + Intronic
915646090 1:157273715-157273737 AAGGAGTTGCAGAGTGGGGATGG + Intergenic
915963903 1:160290058-160290080 GAAGAGTAGCTGCAGGGGGAAGG + Exonic
916397278 1:164404977-164404999 AATGAGAAGCAGAAAAGTGAAGG - Intergenic
916477713 1:165185971-165185993 AATGGCCAGCAGGAGGGGGAGGG - Intergenic
917393092 1:174560718-174560740 AAGGACTACTAGAAGGGGGAGGG - Intronic
917628165 1:176866519-176866541 AGGGAGTGGCAGAAGAGGGAGGG + Intronic
918586234 1:186192177-186192199 GATGACTAGCAGAAAGGGGAAGG + Intergenic
919016767 1:192048510-192048532 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919016798 1:192048676-192048698 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
920079110 1:203359473-203359495 AAGAAGTAGGAGATGGGGGAGGG - Intergenic
920646496 1:207807749-207807771 AGTGAGTAGCAGGAGGAGGAAGG + Intergenic
920674357 1:208029083-208029105 AGTGGGCAGCAGAAGGGGCACGG - Intronic
920965133 1:210694983-210695005 AATGAGAAAGGGAAGGGGGATGG + Intronic
921123066 1:212153406-212153428 AATGAGGGGCAGGAGGTGGAGGG - Intergenic
921472586 1:215567284-215567306 AATGAGGAGGAGGAGGAGGAAGG - Intergenic
921515188 1:216081970-216081992 AATGAATAGAGGAAGGTGGAGGG + Intronic
922207945 1:223465382-223465404 AATGAGGAACAGAAAGGGCAAGG - Intergenic
922555555 1:226529710-226529732 GATGAGTGGCAGAAGTAGGATGG + Intergenic
923339831 1:232997827-232997849 AGTGAGAAGCAGGAGAGGGAAGG + Intronic
923521630 1:234739428-234739450 AAGGGGCAGCAGAAGGGGCATGG - Intergenic
924422442 1:243922295-243922317 AATGAGTAGAAGAAGGGGCAAGG + Intergenic
1063224215 10:4000088-4000110 AAAGAGTATCAGCAGGGGCAGGG - Intergenic
1063662757 10:8045289-8045311 AGTGAGCAGGAGAAGGCGGAGGG + Intergenic
1065373856 10:25016865-25016887 AGCGAGTAGCGGAAAGGGGAAGG - Intronic
1066055060 10:31673216-31673238 AGGGAGTAGCAGATGGGAGAAGG + Intergenic
1069349931 10:67513201-67513223 AAGGAGTACCAGAATGGGTATGG - Intronic
1070305950 10:75239343-75239365 AATGAGTAGCAAAAAGGGGAGGG - Intergenic
1070868902 10:79730746-79730768 AATGTGTAACAGGAGGGAGATGG + Intergenic
1071676410 10:87659796-87659818 GAGGAGTAGGAGAAGGGGGCTGG + Exonic
1071851237 10:89572574-89572596 ACTGAATAGCAGTAGGAGGAAGG + Intergenic
1071932018 10:90483261-90483283 AAAGGGTAGAAGAAGGGTGAGGG - Intergenic
1072105143 10:92266609-92266631 AATGGGAAGCGGGAGGGGGAAGG + Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072603628 10:96957132-96957154 AAATACTAGTAGAAGGGGGAGGG + Exonic
1073358297 10:102874781-102874803 AAGGGGTGGCAAAAGGGGGAAGG + Intronic
1073419041 10:103409000-103409022 AATGAGTACGAGAAAGGGGCTGG + Intronic
1074108817 10:110408427-110408449 ACTGAGGAGGGGAAGGGGGAGGG - Intergenic
1075197978 10:120377779-120377801 AGAGAGGAGCAGAAGGGGAAGGG - Intergenic
1076278785 10:129227414-129227436 TATGGGTAGCAGAAGGGAGAAGG + Intergenic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1078915268 11:15772924-15772946 AATGAGGAGCCTAAGGAGGAAGG + Intergenic
1078996545 11:16706603-16706625 AATGAGAAGCAGAGAGGGGTTGG + Intronic
1079317667 11:19422811-19422833 AATGAATGGCAGAAGGGGAGAGG - Intronic
1079576146 11:22005223-22005245 AATGAATAGCTAAAGGGTGAGGG - Intergenic
1079613193 11:22458222-22458244 GATAAGTAGAAGAAGTGGGAGGG - Intergenic
1080045540 11:27803996-27804018 AATGGGTCACAGAAGAGGGAGGG + Intergenic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080438550 11:32268940-32268962 AATGGGAAGGGGAAGGGGGAGGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081430428 11:42970707-42970729 AATGACTGGCAGATGGGGAAAGG + Intergenic
1081541146 11:44035640-44035662 AAAGAATAGCTGAAGGGGCAGGG + Intergenic
1081720449 11:45285237-45285259 AAAGAGCAGCAGAAGGGGTCTGG - Intronic
1081781830 11:45718428-45718450 AATGAGGAGTAGAAGGAGGCAGG - Intergenic
1082039629 11:47674196-47674218 AAGGAGTGGCAGGAGGGTGAAGG + Intronic
1082821926 11:57549929-57549951 AATGAGGAGCAGAAGGTCAAAGG - Intronic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083808452 11:65088629-65088651 AGTGAGTGGCAGGAGTGGGAGGG - Exonic
1084571662 11:69963417-69963439 AAGGAGGAGGAGGAGGGGGAAGG + Intergenic
1086403818 11:86483232-86483254 GATGAGTAGCAGAGGAGAGATGG + Intronic
1087195642 11:95301792-95301814 AATGAGGAGCAGGGAGGGGAGGG + Intergenic
1087949636 11:104204871-104204893 AAGGAGGATCAGAAGGGAGAAGG - Intergenic
1088047613 11:105472788-105472810 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1088627564 11:111741575-111741597 AATGAGGAGCAGGAGGGAAAAGG - Intronic
1088790106 11:113217294-113217316 ACTGAGTAGAGGAAGGGGCAAGG - Intronic
1088809667 11:113382808-113382830 AACGAGAAATAGAAGGGGGAAGG + Intronic
1088886489 11:114011570-114011592 AAAGAGTAGAAGCAGGGAGAAGG - Intergenic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089586795 11:119514738-119514760 AGTGAGCAGTAGGAGGGGGATGG - Intergenic
1089690579 11:120184551-120184573 AATGAGCAGCAGAGGAGGAAAGG - Intronic
1089725092 11:120470228-120470250 AATGAGTTGAAGAAGGGTGGTGG + Intronic
1092028090 12:5259807-5259829 AGTGAGTAACAGAGGGAGGAGGG + Intergenic
1093084575 12:14852460-14852482 AAGGAGGAGGAGGAGGGGGAGGG - Intronic
1093421738 12:18981887-18981909 AATGACAAACAGAAGAGGGAGGG + Intergenic
1094523689 12:31218352-31218374 AATGAGTAGAAGGAGAGAGAAGG + Intergenic
1095121664 12:38426064-38426086 AAAGGGTAGGAGAAGGGTGAGGG + Intergenic
1095946957 12:47758990-47759012 AATGCGTAGGGGAAGGGGGCCGG + Intronic
1096078278 12:48818200-48818222 AACGAGCGGCAGACGGGGGAGGG - Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096625399 12:52892392-52892414 CATTACTAGAAGAAGGGGGAAGG + Intergenic
1096729982 12:53601660-53601682 AAATAGAATCAGAAGGGGGAAGG - Intronic
1098298360 12:69027821-69027843 AAATAGTAGCTGGAGGGGGATGG - Intergenic
1098310010 12:69139165-69139187 AATGTGTATCAGGATGGGGAGGG + Intergenic
1098848387 12:75565851-75565873 ATGGAGTAACAGATGGGGGAAGG + Intergenic
1098957730 12:76704880-76704902 AATGAGTAAGAGAAGGGGGTGGG - Intergenic
1099616432 12:84941522-84941544 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1099959182 12:89380414-89380436 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1100449926 12:94696063-94696085 GAGGAGCAGCAGCAGGGGGAAGG + Intergenic
1100510082 12:95262046-95262068 AAGGAGTTGGAGAAGTGGGATGG - Intronic
1100550731 12:95644353-95644375 AAGGAGAAGAAGAAGGGGCAAGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100550742 12:95644399-95644421 AAGGGGGAGAAGAAGGGGGAAGG - Intergenic
1100779397 12:98008009-98008031 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1101252802 12:102951788-102951810 AATGAGAAGAAGGAGGGGGAAGG - Intronic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101803004 12:108038864-108038886 AATGAGGAGCAGCAGAGAGAAGG - Intergenic
1102166747 12:110813000-110813022 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102538833 12:113603289-113603311 AATAATTAGGAGAAGGTGGAAGG - Intergenic
1103371575 12:120423329-120423351 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1104001695 12:124864177-124864199 AAGGGGTAGGAGAAAGGGGAAGG - Intronic
1105845794 13:24292539-24292561 AATGAGAAGAGGAAGAGGGAAGG + Intronic
1105914113 13:24896274-24896296 AATGAGTTCCTGAAGAGGGACGG + Intronic
1106550151 13:30764078-30764100 AATGAGAAGTAGAGGGGAGATGG - Exonic
1106771514 13:32965284-32965306 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1106981628 13:35290648-35290670 AAAGAGTAGAAGAAGGGAGAGGG - Intronic
1107235403 13:38162559-38162581 AACGAGTTGCAGAAGGGTGATGG - Intergenic
1107278026 13:38699456-38699478 AATGACTAGCTGAAGGGGCTCGG + Intronic
1107296594 13:38915539-38915561 AATGATTAACATAAGGGTGAAGG - Intergenic
1107795463 13:44046927-44046949 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1108419890 13:50237939-50237961 AATGAGATGTAGAAAGGGGATGG + Intronic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1110036399 13:70690797-70690819 ACTCAGTAGCAGAAGGAAGAGGG - Intergenic
1110071362 13:71182785-71182807 TATGAGTACAAGATGGGGGATGG + Intergenic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1110377170 13:74806447-74806469 AAAGAGTAGCAGAAGATGGCAGG - Intergenic
1112792651 13:103019743-103019765 AAGGAGTAACAGAAAAGGGACGG - Intergenic
1113110175 13:106814287-106814309 AAGGAGCAGGAGAAGGGGAAGGG + Intergenic
1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG + Intergenic
1113967829 13:114164392-114164414 AAGGAGAGGCAGATGGGGGAAGG + Intergenic
1114364242 14:22010019-22010041 GATGAGGAGGAGAAGGAGGAAGG + Intergenic
1114875649 14:26714770-26714792 AATAAGTAGCAGAAGGTGCTAGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115529362 14:34312802-34312824 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
1115659130 14:35474595-35474617 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1116999725 14:51360295-51360317 AATGAGGAGCAGAAGATAGAAGG - Intergenic
1117931471 14:60846147-60846169 AAGGAATAGGAGAATGGGGAAGG - Intronic
1118171860 14:63395952-63395974 GAAGAGGAGGAGAAGGGGGAGGG + Intronic
1118459984 14:65978825-65978847 ACTGGGTAGCAGACAGGGGATGG + Intronic
1118968485 14:70610833-70610855 AAAGAGTCACAGAAGTGGGAGGG + Intergenic
1119257442 14:73210569-73210591 AATGAGTATCAGAAGTGAGGAGG + Intronic
1119442495 14:74637672-74637694 GATGAGGGGCAGAAGGGAGACGG - Intergenic
1119636727 14:76279381-76279403 AAAGAGTGGAAGGAGGGGGATGG - Intergenic
1119874072 14:78042176-78042198 AGTGAGTAGAAGAGTGGGGAAGG + Intergenic
1120281456 14:82443669-82443691 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1120306762 14:82780818-82780840 AAGGAGGAGGAGAAGGGAGAAGG - Intergenic
1121059373 14:90890980-90891002 AATGAGGAGTAGATGGGGGGAGG - Intronic
1121069043 14:90999498-90999520 AATGGGGAGGAGGAGGGGGAGGG + Intronic
1121863589 14:97341777-97341799 AATGAGTAGTAGAAGAGGCAAGG - Intergenic
1122307743 14:100776433-100776455 AATGAGAAGCAGGAGGGAGAGGG + Intergenic
1122392786 14:101401797-101401819 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124363814 15:29057343-29057365 AATGAGTAGAAGAGAGGGGAGGG - Intronic
1124645780 15:31436770-31436792 AATGACTAGCAAAAGGGGGCTGG - Intergenic
1124943308 15:34238784-34238806 AATGTGAAGCTGAAGGGGGTAGG + Intronic
1125547265 15:40515243-40515265 GAGAAGTAGCAGCAGGGGGAGGG - Intergenic
1125697496 15:41651654-41651676 AATGGGGAGGAGAAGGGGGAAGG - Intronic
1126395721 15:48214744-48214766 ATTGAGTGGCAGGAGTGGGAGGG + Intronic
1126856975 15:52848101-52848123 AATGAGCATCAGAAGGCTGAAGG + Intergenic
1127347653 15:58116632-58116654 AATCAGTAGCAGAACAAGGAGGG + Intronic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1130747907 15:86675788-86675810 AATGAGCAGCAGAGGAGAGAGGG - Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131017857 15:89072512-89072534 AAGGATGAGCAGGAGGGGGAGGG + Intergenic
1131852113 15:96554582-96554604 AAAGAGTAGGAGAAGGAGGGAGG - Intergenic
1132445971 15:101918944-101918966 ACAGAGTAGCAGAGGGAGGATGG + Intergenic
1133460758 16:5984197-5984219 GAAGAGAAGAAGAAGGGGGAGGG - Intergenic
1133831344 16:9326244-9326266 AATGAGGACCAGATGGGTGAAGG + Intergenic
1134229796 16:12419895-12419917 TCTGACTAGCAGAAGGGAGATGG + Intronic
1134449249 16:14353824-14353846 GGAGAGTAGTAGAAGGGGGAGGG + Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1135727537 16:24868790-24868812 AAGGAGGAGGAGAAGGGTGAAGG - Intronic
1135920307 16:26643460-26643482 AAAGAGCAGCAGAGGGTGGAGGG - Intergenic
1135948866 16:26893153-26893175 AATGACAAGCAGGAGGGGGCTGG - Intergenic
1137294424 16:47076724-47076746 AAGGAGTAGAACATGGGGGAAGG - Intergenic
1137476385 16:48812996-48813018 AATGGCTAGCAGAAGAAGGATGG + Intergenic
1137955589 16:52825685-52825707 AATGAGTTGCAGAGGGAGGCAGG - Intergenic
1138579411 16:57930558-57930580 AAGGAGGAGGGGAAGGGGGAGGG + Intronic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1139640050 16:68285065-68285087 AAAAAGAAGCAGAAGTGGGAGGG - Intronic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1141193587 16:81842720-81842742 AATCAGTAGCGGGAGGAGGAAGG + Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1141794278 16:86259462-86259484 AAAGAGTACCAGAATTGGGATGG - Intergenic
1142109500 16:88323683-88323705 ACTGAGTGGCAGAAGTGGGCAGG + Intergenic
1142641550 17:1288515-1288537 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641602 17:1288641-1288663 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641670 17:1288786-1288808 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142779479 17:2169843-2169865 ACTGAAGAGTAGAAGGGGGAAGG + Intronic
1143173469 17:4943504-4943526 CATGACTATCAGAAGGGTGAGGG + Exonic
1143613837 17:8037957-8037979 AGTGAGAAGCAGAGGTGGGAAGG - Intergenic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1144300508 17:13919329-13919351 AGTGAGAAGGGGAAGGGGGAAGG - Intergenic
1145217938 17:21066256-21066278 AATGCCTGGCAGAAGGGGGCTGG - Intergenic
1146453704 17:32993815-32993837 AAGGAGGAGCAGGAGGGGAACGG + Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1147168466 17:38605323-38605345 GGTGAGGAGAAGAAGGGGGATGG - Intronic
1147599724 17:41738424-41738446 GATGAGAAGCAGGAGAGGGAGGG - Intergenic
1147669120 17:42166574-42166596 AAGTAGTAGCTGCAGGGGGATGG - Intronic
1147715348 17:42503488-42503510 AATTAGTATCAGAAGAGGGAAGG - Intronic
1148356931 17:46981628-46981650 AATGAGTATCAGGATGGGTATGG - Intronic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1149103051 17:52928834-52928856 AATTAGGAGGAGAAGGAGGATGG + Intergenic
1149662094 17:58339354-58339376 CTTGAGTAGCAGAAGGCAGAGGG - Intergenic
1150518626 17:65842424-65842446 AATGTGCAGCAGAAGGCAGAGGG + Intronic
1150724731 17:67642433-67642455 AGGGGGTAGCAGAAGAGGGAAGG - Intronic
1150804279 17:68306965-68306987 ACTGAGTAGCAGATGGTTGAGGG - Exonic
1151049516 17:70961290-70961312 TATTAGTAACAGAAGAGGGAAGG + Intergenic
1151441467 17:74132078-74132100 GAGGAGCAGCAGAAGCGGGAAGG - Intergenic
1152008496 17:77696846-77696868 AAGGAGGAGGAGAAGGGAGAGGG - Intergenic
1152024912 17:77802720-77802742 TCTAGGTAGCAGAAGGGGGAGGG - Intergenic
1152066692 17:78115986-78116008 AGTGAGTTGCAGAAGGGGGTCGG - Intronic
1152820294 17:82434328-82434350 AGTGAGTGGCAGGAGGGGCAAGG - Intronic
1153212017 18:2777440-2777462 AATGACTAGGGGAAGGGGCAAGG - Intronic
1153509453 18:5835926-5835948 AGGGAGTAGAAGAAGAGGGAAGG + Intergenic
1154305767 18:13229709-13229731 AAAGAGTAGAAGGAGAGGGAAGG - Intronic
1154964957 18:21347397-21347419 AAGGAGCAGCAGAAGCAGGAAGG - Intronic
1155449819 18:25951827-25951849 AAGGAGTAGCAGAAGTGGGTAGG - Intergenic
1155546904 18:26924911-26924933 AATGAATAACTGAAGGTGGAAGG - Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156398196 18:36717945-36717967 GATGATGAGGAGAAGGGGGATGG + Exonic
1156535899 18:37864231-37864253 AATTTGTAGCAGAAAGTGGAAGG + Intergenic
1156723924 18:40104570-40104592 AATAAGGAGGAGAAGGGGAAGGG + Intergenic
1157161678 18:45319236-45319258 AGTGGGTAACAGAAGAGGGAGGG - Intronic
1157385587 18:47257372-47257394 AAGGAGTGGGAGTAGGGGGAGGG + Intergenic
1158217774 18:55117724-55117746 AAAAAGTAGAAGAAGGAGGAGGG + Intergenic
1158903912 18:61992435-61992457 AATGAGAAGGAAAATGGGGAGGG + Intergenic
1159869597 18:73745357-73745379 AATGACTAGCAGTTGGGGGATGG - Intergenic
1160017829 18:75157901-75157923 ATTGGGTATGAGAAGGGGGAGGG - Intergenic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160639336 19:114763-114785 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1160965698 19:1746102-1746124 AAGGGGGAGTAGAAGGGGGAAGG + Intergenic
1161254463 19:3299672-3299694 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1161370539 19:3908653-3908675 AAGGAGGAGAAGAAAGGGGAAGG - Intronic
1161403794 19:4080919-4080941 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1161410110 19:4112386-4112408 CATGAGGAGGAGATGGGGGAGGG + Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162078572 19:8205401-8205423 GATGAATAGGAGAAGAGGGAGGG - Intronic
1162108873 19:8389499-8389521 AAAGAATAGCAGAAAGTGGACGG + Intronic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1163983635 19:20924634-20924656 AATGTGTATCAGAGAGGGGAAGG - Intronic
1164335919 19:24321266-24321288 AAGGAGTAGCTGAAGGGAGAGGG - Intergenic
1164441710 19:28284525-28284547 AAAGAGGAGAAGAAGGGTGAAGG + Intergenic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1164776831 19:30859241-30859263 AAGGAGTAGCAGAAGTTGGATGG + Intergenic
1164880613 19:31729653-31729675 ACTGAGTTACAAAAGGGGGATGG + Intergenic
1166034961 19:40161420-40161442 GAAGAGAAGCAGAAGGGGAAGGG + Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1166652133 19:44582654-44582676 AAGGAGAAGGAGAAGGGGAAAGG + Intergenic
1166674947 19:44734657-44734679 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1166960290 19:46492917-46492939 AAAGAGGAGGAGGAGGGGGAGGG - Exonic
1167471723 19:49679450-49679472 CATGAATAGCAGAAGGGAGCGGG - Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167702107 19:51054956-51054978 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1167775643 19:51553004-51553026 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1167986799 19:53325247-53325269 CATGGATGGCAGAAGGGGGATGG - Intergenic
1168251574 19:55145314-55145336 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
925831372 2:7899269-7899291 TATGAGTAGGAGCAGGAGGAAGG - Intergenic
926018296 2:9473799-9473821 GATGAGTAACAGAAGGGCCAGGG - Intronic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
927493737 2:23538134-23538156 AATAAGTAGCAGAACTAGGATGG + Intronic
927866177 2:26589153-26589175 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
928108444 2:28488178-28488200 AAGGAGGAGAAGGAGGGGGAGGG + Intronic
928551704 2:32378244-32378266 AATGAGTAGGAGAGGGGGCTGGG - Intronic
929928984 2:46237699-46237721 AAAGAGGAGCACAAGAGGGAGGG - Intergenic
930208238 2:48609536-48609558 AATGAGTAGGAGACAGAGGAAGG - Intronic
931111492 2:59115876-59115898 AATGTGGAGGAAAAGGGGGATGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931183475 2:59927054-59927076 AGTGAGAAGCAGGAGGGGGTAGG + Intergenic
931330080 2:61271689-61271711 AAGGAGGGGAAGAAGGGGGAAGG + Intronic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931826301 2:66004196-66004218 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
932429568 2:71666038-71666060 AATGAGAAGGAGGAGGGGGTGGG - Intronic
932608232 2:73178209-73178231 AGTAAGTGGCAGAAGGGGGGGGG - Intergenic
933156496 2:78981280-78981302 AATAAGTAACAGAAGGGGCATGG - Intergenic
933466464 2:82658187-82658209 GATGGGCAGCCGAAGGGGGATGG - Intergenic
933787472 2:85854931-85854953 TACGAGTAACAGAAGGGCGAAGG + Intronic
934019804 2:87936145-87936167 AGTGAGTGGCTGAAGTGGGATGG + Intergenic
934155460 2:89195839-89195861 AAGCAGTAGGAGAATGGGGAAGG - Intergenic
934211863 2:89986919-89986941 AAGCAGTAGGAGAATGGGGAAGG + Intergenic
934946049 2:98542814-98542836 ACAGGGTAACAGAAGGGGGAAGG - Intronic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
936876494 2:117195958-117195980 AATTAGTAACAGAAGCGGGGAGG + Intergenic
936985507 2:118308677-118308699 GAGGAGTAGGAGAAGAGGGAGGG + Intergenic
937130905 2:119512334-119512356 AAGGAGAAGGAGAAGGGGAAGGG - Intronic
938941651 2:136174999-136175021 AATGAGTAGATGAAGGCAGAAGG - Intergenic
938976335 2:136481786-136481808 AATGACTAGGAGAAGTGGCAGGG + Intergenic
939069454 2:137521492-137521514 AATGAGAAGAAAAAGAGGGATGG - Intronic
940711928 2:157173063-157173085 AATGAATAGCAGATGTGGGAAGG - Intergenic
942069708 2:172305222-172305244 AATGAGTAGCAGATGTTGGGAGG + Intergenic
943199927 2:184809324-184809346 AATGAGTAGGAGAAAGTGAATGG + Intronic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
945264938 2:207881772-207881794 AAAGAGTAGGAGAAAGGGAAGGG - Intronic
945708931 2:213271744-213271766 AATGAGTTGATGTAGGGGGAAGG + Intergenic
945856511 2:215075137-215075159 AATCCTTAGCAGAAGGGAGATGG + Intronic
946687976 2:222290935-222290957 AAAGAGGAGAAGAAGGGGGGAGG + Intronic
948091780 2:235301718-235301740 GATGAGGGGGAGAAGGGGGAAGG - Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948513924 2:238491054-238491076 AGCGAGTAGCTGAAGGGGAAGGG - Intergenic
948539004 2:238672376-238672398 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948558594 2:238835350-238835372 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
948735729 2:240003769-240003791 GATGAGAAGCAGCAGGGGGTGGG + Intronic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1168870734 20:1126031-1126053 TGTGAGTGGCAGATGGGGGAGGG - Intronic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1168905898 20:1403533-1403555 GATGGGCAGCAGGAGGGGGAGGG + Intergenic
1169765574 20:9144661-9144683 AAGGAGGAGGAGGAGGGGGAAGG + Intronic
1170579238 20:17685244-17685266 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1170599295 20:17828701-17828723 GATGAGTAGCTGATGGGGTAAGG + Intergenic
1172895235 20:38295553-38295575 GATGTGAAGCAGAGGGGGGATGG + Intronic
1173117906 20:40263452-40263474 AAAAGGTAGCAGATGGGGGAGGG + Intergenic
1173775128 20:45698985-45699007 AAGGAGGAGAAGGAGGGGGAGGG + Intronic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177507230 21:22034750-22034772 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1178123086 21:29489249-29489271 AATGAGGGGCAGAAGGCAGAAGG - Intronic
1178456895 21:32763295-32763317 AATGTCTAGCAGGAGGGGAAAGG - Intronic
1179286703 21:39983816-39983838 GATGTGGTGCAGAAGGGGGAAGG - Intergenic
1182122098 22:27794890-27794912 GATGAGAAGGGGAAGGGGGAGGG + Intronic
1182309573 22:29395029-29395051 TCTGAGTATCAGAAAGGGGAAGG - Intronic
1182886410 22:33777672-33777694 AAGGAGAAGGAGAAGGGGAAGGG + Intronic
1183731765 22:39622364-39622386 ATTGAGTAGGTGGAGGGGGAGGG + Intronic
1184449686 22:44575634-44575656 GATGACAAGGAGAAGGGGGATGG + Intergenic
1184805633 22:46793294-46793316 ACTCAGTGGCAGGAGGGGGAGGG - Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
949366267 3:3284995-3285017 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
949575186 3:5331887-5331909 AAAGAGGAGAAGAAGGGGGCAGG - Intergenic
949616802 3:5762531-5762553 AATGAGCGGCAGCAGTGGGATGG + Intergenic
949936625 3:9121038-9121060 AATTAGGAGCAGAACTGGGATGG - Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
951350802 3:21604686-21604708 AATTAGTAGAATAAGGTGGAAGG + Intronic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
952470922 3:33650762-33650784 AAGGAGTACAAGAAGGGAGAAGG + Intronic
952688142 3:36173011-36173033 AATGATTATCAGAAGGAGAAAGG - Intergenic
954326756 3:49868270-49868292 AAAGGATAGCAGATGGGGGAGGG - Intronic
955425941 3:58790161-58790183 AATAATTAGAAGAAGGAGGAAGG - Intronic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
958114345 3:89196026-89196048 AATGACTGGGAGAAGGAGGAAGG - Intronic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959693624 3:109225691-109225713 AATGATAAGCAGAAGGAAGATGG + Intergenic
959918131 3:111841328-111841350 ATTGAGTAGGAGTAGGAGGAGGG + Intronic
959963814 3:112332219-112332241 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
960128951 3:114032648-114032670 AATGAGTGAGAGAAGGGGTAGGG - Intronic
960845557 3:122001399-122001421 AATCAGCAGCAGGAGGAGGAGGG + Exonic
961272541 3:125699866-125699888 GAAGAGTATCAGAGGGGGGAGGG + Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
962966877 3:140363885-140363907 AATGAGGAGCAGTAGGAGGCAGG + Intronic
963754973 3:149225522-149225544 AATGGGCAGCCAAAGGGGGATGG - Intergenic
964812900 3:160684713-160684735 CATGTGTAGCAGGAGGTGGAGGG - Intergenic
965069144 3:163895120-163895142 ATTAAATAGCAGAAGGGGGAAGG + Intergenic
965995596 3:174878730-174878752 AATGAACAGCAGAAGGGGTGGGG - Intronic
966672842 3:182547850-182547872 AATCAGTCGGAGAAGGGAGAAGG + Intergenic
967133482 3:186493977-186493999 AATCACTAGGAGAAGGGCGAGGG - Intergenic
967311437 3:188110095-188110117 ATTGAGTGGCAGTAGGGGAAGGG + Intergenic
967348084 3:188480951-188480973 TATGATTAGAAGAAGGGGGAAGG - Intronic
967548821 3:190765275-190765297 ACTAAGTAGCAGAAAGGGGTAGG + Intergenic
967771667 3:193340595-193340617 AATGAAGAGAAGAAGAGGGAAGG + Intronic
967833778 3:193943880-193943902 AATGAGCAGCTGTATGGGGATGG + Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
971265632 4:25094130-25094152 GATGAGAAGCAGAGGAGGGAAGG - Intergenic
971305117 4:25473295-25473317 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
972279511 4:37588548-37588570 GATGAGGAGAAGAAGGTGGAAGG - Intronic
973043875 4:45510657-45510679 AAAGGATAGCAGAAGGGTGAGGG - Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
975360210 4:73460925-73460947 AAGGAGGAGGGGAAGGGGGAGGG - Intergenic
976611063 4:87030865-87030887 AATGAGGAGCAAAAGGGGTCTGG + Intronic
976633843 4:87267529-87267551 AATAAGAAGGAGAAGGGAGATGG - Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977701477 4:100027931-100027953 AATGAGTAGCAGAAGAAGGTAGG - Intergenic
981234571 4:142399854-142399876 AATGCTTAGCAGGTGGGGGAGGG - Intronic
981658107 4:147135224-147135246 AAAAAGTAGGAGAAAGGGGAAGG - Intergenic
982977968 4:162090960-162090982 CATGAGGAGCAGAAAGGTGATGG - Intronic
983544924 4:168953023-168953045 AAGGACTAGCAGGTGGGGGAAGG + Intronic
983903342 4:173159866-173159888 AATGGGTATCTGAAGGGAGATGG - Intergenic
984371698 4:178874885-178874907 AATGGGTAGGGGAAGGGGGATGG + Intergenic
984784506 4:183555040-183555062 AATGAGCAGAGGAAGAGGGAGGG - Intergenic
985140940 4:186840379-186840401 AAGGAGGAGAAGGAGGGGGAGGG - Intergenic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
988104118 5:26721281-26721303 AATGAATAGAAGCAGGGGCAAGG - Intergenic
988152329 5:27400228-27400250 GAAGAGTAGCAGAGGGGTGAGGG + Intergenic
989087877 5:37695157-37695179 CAGGAGTAAGAGAAGGGGGAGGG + Intronic
990897928 5:60718826-60718848 AAAGAGTTGGAGAAGGTGGAAGG - Intergenic
990916429 5:60911201-60911223 AATGTGGAGAAGTAGGGGGAGGG - Intronic
991036402 5:62131940-62131962 AGGGAGCAGGAGAAGGGGGATGG - Intergenic
991185097 5:63797077-63797099 AATGAGGAGGAGGAGGAGGATGG + Intergenic
991991454 5:72344047-72344069 GATGAGTAGATGAAGGGGGTCGG + Intronic
992093208 5:73338033-73338055 AGTGATTAGGAGAAGGGAGAGGG - Intergenic
992849712 5:80794643-80794665 GGTGGGTAGCAGAAGGGAGAAGG + Intronic
993488859 5:88521948-88521970 AATAAGTAGCAAAAGGGTTATGG + Intergenic
993716128 5:91277355-91277377 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994727592 5:103454571-103454593 AATGAGGGGCAGAATGGGCAAGG - Intergenic
995483251 5:112613977-112613999 AGTGAAAAGCAGAAGGGGAATGG + Intergenic
995878727 5:116820239-116820261 AATGATTAGAAGAAGGTAGATGG + Intergenic
996437237 5:123448266-123448288 AATGAGTAGCAGAAGAGGTTTGG + Intergenic
997225740 5:132208372-132208394 AGAGAGGAGGAGAAGGGGGAGGG + Intronic
997750137 5:136336474-136336496 AATGAGAAGCAGAAAGGGCTAGG + Intronic
998798404 5:145843127-145843149 AATGGGTAGGAGAAGGGGAAAGG + Intergenic
998874337 5:146584095-146584117 AATGAGCAGCAGGGGCGGGAAGG + Intronic
998929319 5:147163144-147163166 AAGGAAGAGAAGAAGGGGGAAGG - Intergenic
999001511 5:147928823-147928845 AATTAGTACAAGAAGGAGGAAGG - Intergenic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
999835728 5:155368833-155368855 AGAGAGTAACAGAAAGGGGAGGG - Intergenic
999921746 5:156329140-156329162 AGTAAGCAGCGGAAGGGGGAAGG + Intronic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000219713 5:159201816-159201838 AATGAGTAACAGAGATGGGAGGG + Intronic
1000371411 5:160540086-160540108 AGTGAGTGGCTGAAGTGGGATGG + Intergenic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1002134294 5:177098450-177098472 AATGCTGAGCAGATGGGGGAGGG - Intergenic
1002746687 6:63169-63191 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1003612132 6:7623128-7623150 AATGAGTAGCAGGATAGTGAGGG - Intergenic
1004124792 6:12862778-12862800 AATTAGTAGTAGAAGGTGCATGG - Intronic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1005839093 6:29728856-29728878 AATGCGTCGCTGAAGGGAGAGGG - Intronic
1005857029 6:29870435-29870457 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1005862848 6:29914586-29914608 ATTGAGAAGCAGGAGGGTGAAGG + Intergenic
1005874351 6:29999784-29999806 ATTGAGGAGCAGGAGGGTGAAGG + Intergenic
1007829056 6:44624490-44624512 AATGAGAACCTGAAGGAGGAGGG + Intergenic
1008016429 6:46525630-46525652 AAGGAAGAGAAGAAGGGGGAGGG + Intergenic
1008595441 6:53037248-53037270 AATCAATAGAAGAAGGGGCAGGG + Intronic
1009380494 6:63023007-63023029 AATGAGAAGTAGATGGGAGAAGG - Intergenic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1010570401 6:77466863-77466885 AATCAGTAGCGGAAGGGAAAGGG + Intergenic
1011658805 6:89576507-89576529 AAGGAGTAGCAGAAAAGTGAAGG - Intronic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1014294200 6:119598407-119598429 AAGGAGAAGGAGAAGGGGAATGG + Intergenic
1014344799 6:120254614-120254636 AAAGAGGAGGAGATGGGGGAGGG + Intergenic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1017096866 6:150812384-150812406 AAAGAGTAGCAGAGGAGGCAGGG + Intronic
1017339568 6:153305201-153305223 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339582 6:153305249-153305271 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1017339615 6:153305369-153305391 AAGGAGGAGGAGAAGGGGAAGGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017744697 6:157436053-157436075 ACTGAGTAGCTGATGAGGGAAGG + Intronic
1018206983 6:161445433-161445455 CATGTGTAGGAGAAAGGGGAGGG - Intronic
1020113156 7:5459304-5459326 AATAAATAGCACAAGGGGGCCGG + Intronic
1020240396 7:6390010-6390032 AAGGAGTAGGAGAGGAGGGAAGG - Intronic
1020415068 7:7936045-7936067 AATGGGTAGCTGAAGTGGGGTGG + Intronic
1020675018 7:11172681-11172703 AACAAATAGCAGAAGCGGGAAGG + Intergenic
1021163495 7:17304920-17304942 TTTGCGTAGAAGAAGGGGGAGGG + Intronic
1021697159 7:23286448-23286470 AATGAGCAGGAGACGGGGGAGGG - Intergenic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1022274416 7:28841799-28841821 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1023710977 7:42992279-42992301 CAGGAGTAGCAGAAGGGGACAGG - Intergenic
1024171329 7:46791038-46791060 AATGAGTACAAGGAGGGTGAAGG + Intergenic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1027332029 7:77107248-77107270 AATGAGAAGGAGAAGGGGAAGGG - Intergenic
1028070828 7:86448038-86448060 AAGGAGGAGGAGGAGGGGGAGGG + Intergenic
1029027180 7:97429174-97429196 AATGAGTAGGAGAAAGGGCAAGG + Intergenic
1029458411 7:100682474-100682496 TATGAGTCACTGAAGGGGGAGGG + Exonic
1029505988 7:100964594-100964616 AAAGTGCACCAGAAGGGGGAAGG - Intronic
1029783746 7:102764077-102764099 AATGAGAAGGAGAAGGGGAAGGG + Intronic
1029925156 7:104308177-104308199 AATGAGTAGGAGAAGGATTATGG + Intergenic
1031010441 7:116521084-116521106 AATGAATAGCAGAAGGCCTATGG + Intergenic
1032070131 7:128799701-128799723 AATGAGCAGAAGTTGGGGGAAGG + Intronic
1032807749 7:135374154-135374176 GATGGGCAGCAGAAGGGGAAAGG - Intronic
1033077055 7:138259386-138259408 AGGGAGTAGATGAAGGGGGAGGG + Intergenic
1033205180 7:139414131-139414153 AATGAGGTGAAGAAGGGGGGTGG - Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034354418 7:150441860-150441882 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1035147080 7:156829672-156829694 AATGAGGAGCAGCAGGGCCATGG - Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1036763850 8:11533616-11533638 GAGGAGTAGGAGGAGGGGGAAGG + Intronic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1038774622 8:30517456-30517478 AATTAGTGGCTGAAGGTGGAGGG + Intronic
1040070250 8:43181396-43181418 AATGAGTATCAGAGTCGGGAGGG + Intronic
1040507240 8:48059884-48059906 AAAGAGCAACAGAATGGGGATGG - Intronic
1040571506 8:48615556-48615578 AATGAGAAGCAGAACTGTGAGGG - Intergenic
1040666213 8:49636721-49636743 AATGAGTAGAAGACTGGGGTTGG - Intergenic
1041265724 8:56062724-56062746 AATCAGTAGCAGAAGGAAAACGG + Intergenic
1042130429 8:65582486-65582508 AAGAAGGAGGAGAAGGGGGAGGG + Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1042966834 8:74362581-74362603 AAAGAGTAGCTGAAGGGTCAGGG - Intronic
1044422933 8:92019406-92019428 AAGGAAGAGCAGGAGGGGGAGGG + Intronic
1044731943 8:95235955-95235977 AATGATGAGCAACAGGGGGATGG + Intergenic
1046285894 8:112092485-112092507 AGTGAGGAGCAGCAGGGGCAGGG + Intergenic
1046538280 8:115544853-115544875 AAGGAGGAGAAGAAGGTGGAGGG + Intronic
1046625464 8:116572311-116572333 GATGAAGAGAAGAAGGGGGAGGG - Intergenic
1047398369 8:124524693-124524715 AAGGTTTTGCAGAAGGGGGAGGG + Intronic
1047994336 8:130319252-130319274 AATTAGTAGCAGCTGGGGGCTGG - Intronic
1048261093 8:132945649-132945671 AATGAGGAGATAAAGGGGGATGG + Intronic
1048276118 8:133067299-133067321 AAGGAGAAGCAGATGGGGGTGGG - Intronic
1048280615 8:133102900-133102922 TGTGGGTAGCAGTAGGGGGAGGG + Intronic
1048572942 8:135669952-135669974 AATGTGAGGCAGAAGAGGGAGGG - Intergenic
1048633874 8:136274515-136274537 GATGAGTAGGAGTAGGGGGTTGG + Intergenic
1048650976 8:136477381-136477403 TATGAGTAGCAGAGGGATGAAGG - Intergenic
1048696272 8:137031659-137031681 AATTAGGAGGAGAAGGGGGAGGG - Intergenic
1051310560 9:15766489-15766511 ATTAAGTAGCAGAAGGGCAATGG + Intronic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1052682780 9:31715613-31715635 AATGACTGGCACAAGGGGCAGGG + Intergenic
1052968769 9:34363625-34363647 AGAGAGCAGCAGCAGGGGGAAGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053308125 9:36997992-36998014 AATGAGGAGCAGAAGAGTCAAGG - Intronic
1053352708 9:37424136-37424158 ACTGAGCAGGAGAAGGTGGAAGG + Intronic
1055001088 9:71449286-71449308 AATGAATATCAGAAGAGGAAAGG - Intergenic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056546844 9:87620554-87620576 AAGGAGTAGGGGGAGGGGGAGGG + Intronic
1056964364 9:91153627-91153649 AATGAGTAGGGAAAGGTGGAGGG + Intergenic
1057339814 9:94190056-94190078 AATGAGAAGCAGGAGGGGAGTGG - Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057936392 9:99242931-99242953 AATGAGGACCAGAAAGGTGAAGG - Intergenic
1058125659 9:101191445-101191467 AAAGAGTAACAGAAGTGGAACGG - Intronic
1058786269 9:108391763-108391785 AAGGAGTAGCAGGGGAGGGAGGG + Intergenic
1058905260 9:109477654-109477676 AATTATTAGCAGCAGCGGGAGGG + Intronic
1059508551 9:114822371-114822393 AAAGAGTAGCATAAGGAGGTGGG + Intergenic
1060268610 9:122126428-122126450 AATGTGAAGCTGGAGGGGGAGGG + Intergenic
1061184479 9:129044284-129044306 AAAGAGTAGAAGAAGGGGCCAGG - Intronic
1061899691 9:133666542-133666564 AAGGAGGAGAAGGAGGGGGAAGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062469704 9:136697007-136697029 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185662053 X:1735650-1735672 AAAGAGGAGGAGGAGGGGGAGGG - Intergenic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186362102 X:8852940-8852962 AATGAGCAACAGATGGGGCAAGG - Intergenic
1186471160 X:9823075-9823097 AAGGAGGAGGAGAAGGGAGAAGG - Intronic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186532850 X:10314687-10314709 AATGAGAGGCAGGAGAGGGAAGG + Intergenic
1187029369 X:15469925-15469947 AGTGAGTGGCAGAAGGAGTATGG + Intronic
1187843793 X:23515444-23515466 AAGGAGAAGGAGAAGGGGAAGGG - Intergenic
1188338932 X:28975246-28975268 CAAGAGTTGCAGAAGGGGCAGGG - Intronic
1188724276 X:33562286-33562308 GAAGAGGAGCAGGAGGGGGAGGG - Intergenic
1189684398 X:43548814-43548836 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1190239254 X:48644598-48644620 AATAAGTAGGAGAAGGAGAAGGG - Intergenic
1192230386 X:69260592-69260614 CCTCAGTAGCAGAAGGGGCAAGG + Intergenic
1193363954 X:80608368-80608390 AGTGAGAAGTAGAAGGGGCAGGG - Intergenic
1193846540 X:86479030-86479052 GTTGGGGAGCAGAAGGGGGATGG + Intronic
1195206045 X:102601124-102601146 AATCAGCAGCAGCAGGGGGTGGG - Exonic
1195696231 X:107669609-107669631 AAGGAGGAGGAGGAGGGGGAAGG - Intergenic
1195962301 X:110398292-110398314 AATGTGTAGATGAAGGGAGATGG + Intronic
1196421977 X:115532129-115532151 AATGAGTTGAAGTAGCGGGAGGG - Intergenic
1196806269 X:119589656-119589678 AAAGAGCAGCATAAGCGGGAAGG - Exonic
1197160121 X:123313547-123313569 AGTGAGAAGGAAAAGGGGGAAGG - Intronic
1197734478 X:129840682-129840704 CTTGAGTAACAGCAGGGGGAGGG - Intronic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1198741130 X:139844311-139844333 AAGGAGTAGCAGAGAGTGGAGGG + Intronic
1199124724 X:144102986-144103008 AGTGAGTGGCTGAAGTGGGATGG - Intergenic
1200010001 X:153113745-153113767 TTTGAGAACCAGAAGGGGGAAGG - Intergenic
1200029599 X:153286177-153286199 TTTGAGAACCAGAAGGGGGAAGG + Intergenic
1200167937 X:154050292-154050314 AATGAGTGGCAGAAGAGACAGGG + Intronic
1200379711 X:155822203-155822225 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200379719 X:155822227-155822249 AAGGAGAAGGAGAAGGGGAAGGG + Intergenic
1200985843 Y:9303263-9303285 AATGACTGGCAGCAGGGGGTGGG + Intergenic
1201300227 Y:12498706-12498728 AAAGAGGAGAAGGAGGGGGAAGG - Intergenic
1201300269 Y:12498827-12498849 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1201461744 Y:14233036-14233058 AATGAGGAGGAGGAGGGGGAGGG - Intergenic
1201739703 Y:17310939-17310961 AAGGAGGAGGAGAAGGGGGGAGG - Intergenic
1202124733 Y:21557632-21557654 AATGACTGGCAGCAGGGGGTGGG - Intergenic
1202154275 Y:21871748-21871770 AATGACTGGCAGCAGGGGGTGGG + Intergenic
1202195251 Y:22294442-22294464 AATGACTGGCAGCAGGGGGTGGG + Intergenic