ID: 1140733082

View in Genome Browser
Species Human (GRCh38)
Location 16:77873970-77873992
Sequence CTCTGGTTCTGCAGAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 291}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140733082_1140733088 7 Left 1140733082 16:77873970-77873992 CCTGCTTCTCTGCAGAACCAGAG 0: 1
1: 0
2: 1
3: 33
4: 291
Right 1140733088 16:77874000-77874022 GACAGAGCAACAGGTCAAGGTGG 0: 1
1: 0
2: 0
3: 24
4: 272
1140733082_1140733090 20 Left 1140733082 16:77873970-77873992 CCTGCTTCTCTGCAGAACCAGAG 0: 1
1: 0
2: 1
3: 33
4: 291
Right 1140733090 16:77874013-77874035 GTCAAGGTGGGACTAATACAAGG 0: 1
1: 0
2: 0
3: 5
4: 93
1140733082_1140733085 -2 Left 1140733082 16:77873970-77873992 CCTGCTTCTCTGCAGAACCAGAG 0: 1
1: 0
2: 1
3: 33
4: 291
Right 1140733085 16:77873991-77874013 AGTCCAGCGGACAGAGCAACAGG 0: 1
1: 0
2: 0
3: 4
4: 129
1140733082_1140733089 8 Left 1140733082 16:77873970-77873992 CCTGCTTCTCTGCAGAACCAGAG 0: 1
1: 0
2: 1
3: 33
4: 291
Right 1140733089 16:77874001-77874023 ACAGAGCAACAGGTCAAGGTGGG 0: 1
1: 0
2: 1
3: 18
4: 221
1140733082_1140733087 4 Left 1140733082 16:77873970-77873992 CCTGCTTCTCTGCAGAACCAGAG 0: 1
1: 0
2: 1
3: 33
4: 291
Right 1140733087 16:77873997-77874019 GCGGACAGAGCAACAGGTCAAGG 0: 1
1: 0
2: 0
3: 19
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140733082 Original CRISPR CTCTGGTTCTGCAGAGAAGC AGG (reversed) Intronic
900492543 1:2959528-2959550 CACTGGTTGGGCAGAGATGCTGG + Intergenic
900876011 1:5343155-5343177 CACTGGTGCTGCAGGGAACCCGG + Intergenic
901141588 1:7037309-7037331 TCCTGGTTCTGCAGTGATGCTGG - Intronic
902434921 1:16392301-16392323 GTTTGGTTCTGAAGAGAAGCTGG + Intronic
902949268 1:19869027-19869049 CACTGGTCCTGTAGAGTAGCTGG - Intergenic
903279914 1:22244577-22244599 CTCAGGGTGTGCAGAGAAGCAGG - Intergenic
903551709 1:24161676-24161698 CTCTGTTTCTGCAGTGGAGCCGG - Exonic
903672919 1:25047020-25047042 GTGTGGGTCTGCAGAGCAGCTGG - Intergenic
904496095 1:30887564-30887586 CCCTGGTTTTGCAGACTAGCTGG - Intronic
904704646 1:32380747-32380769 GACTGCTTCTGCAGAGCAGCGGG - Intronic
905216824 1:36414549-36414571 ATCAGGTGCTGCAGAGAAGATGG - Intergenic
905598051 1:39225616-39225638 CTCTGCTTCTGTAGAGATGCTGG + Intronic
905866458 1:41379598-41379620 CTCAGGGTCTCCAGAGAACCAGG + Intronic
908903137 1:68979247-68979269 CTCAGTTTCTGAAGAAAAGCAGG - Intergenic
910244536 1:85124386-85124408 CAGTGGTTCTGCTGACAAGCTGG - Intronic
911713896 1:101108783-101108805 CTCTAGTTCTGCAAAGAATGTGG - Intergenic
912242598 1:107927046-107927068 CTTTGCTTCAGCAGAGAAGATGG + Intronic
913346608 1:117816639-117816661 GTCCGGTTCTGCACAGAAGCTGG + Intergenic
914326120 1:146618609-146618631 CTCTCTTCCAGCAGAGAAGCTGG + Intergenic
916316455 1:163453915-163453937 CTCTATTTCTACAGAGAATCAGG + Intergenic
916519844 1:165553726-165553748 CTCTGGGACTGCAGAGAAGGAGG + Intronic
916772527 1:167926003-167926025 TTCTCATTCTTCAGAGAAGCTGG + Intronic
920933327 1:210408779-210408801 CTCTGGTTCTAGAGAGCACCTGG + Intronic
922892243 1:229071109-229071131 GTCTTGTTCTCCAGAGTAGCTGG - Intergenic
923427017 1:233881012-233881034 CTCTGGTTTTGCAGAGCTGAGGG + Intergenic
924465932 1:244299263-244299285 TTGTGTCTCTGCAGAGAAGCAGG - Intergenic
924566343 1:245201838-245201860 CTCCTGTGCTGCAGAGTAGCTGG - Intronic
924825201 1:247531560-247531582 CTGTGGCTCTGCAGGCAAGCTGG - Exonic
924836434 1:247652497-247652519 TTGTGGTTCTCCAGAGAAGATGG - Intergenic
1062788549 10:285547-285569 CTCTGCTTCCTCATAGAAGCAGG + Intronic
1065300853 10:24319775-24319797 CTATGGTTCTGAATACAAGCAGG - Intronic
1067074600 10:43169030-43169052 CTCTAGGTGTGCTGAGAAGCAGG + Intronic
1067776967 10:49170920-49170942 CCCTGGCTCTGCAAAGTAGCTGG + Intronic
1069020598 10:63483740-63483762 TTTGGGTTCTGCAGAGAATCAGG - Intergenic
1070407102 10:76106776-76106798 CTCTTGTCCCGCAGAGAATCTGG - Intronic
1073070524 10:100790610-100790632 CTCTTCCTCTGCAGACAAGCAGG + Intronic
1073080781 10:100859344-100859366 CTCTCCTTCTGGGGAGAAGCTGG + Intergenic
1073734494 10:106330332-106330354 TTCTGATTCTGAAGAGCAGCTGG - Intergenic
1074671894 10:115800578-115800600 CTCTGGTGCAGGAGATAAGCAGG - Intronic
1074701769 10:116098581-116098603 CTCCGGTTCTGCACACAACCTGG + Intronic
1074876721 10:117619330-117619352 CCCTGAGTCTGCAGAGGAGCCGG + Intergenic
1075466216 10:122652654-122652676 CTCTGGGACTGCAGTCAAGCTGG + Intergenic
1075571967 10:123552712-123552734 ACCTGGTTCAGCAGAGAAGCTGG - Intergenic
1076934091 10:133555895-133555917 CCTTTGTGCTGCAGAGAAGCTGG - Exonic
1077253491 11:1571025-1571047 CTCTGGTGCTGCAGTGATGGGGG - Intronic
1077354648 11:2109448-2109470 CCCTGGGGCTGCAGACAAGCTGG + Intergenic
1078407024 11:11079332-11079354 ATCTGGTTTTGCAGACAAGTTGG + Intergenic
1079450761 11:20598221-20598243 CTCGGGCTCTCCAGAGGAGCAGG + Intergenic
1081723158 11:45304710-45304732 CTCTGCTTCTGCAGAGCTCCTGG - Intergenic
1082879881 11:58027210-58027232 CTCTTGTTCTGCAGAGAAATGGG - Intronic
1083333815 11:61911645-61911667 CTCTGTTTCTGCAGGGAACGGGG - Intronic
1083695319 11:64438680-64438702 ATCTGGCTCTGCACAGTAGCTGG + Intergenic
1083851509 11:65370337-65370359 CCCTGGTTCTGCAGAGGACTGGG + Intergenic
1083902658 11:65651099-65651121 ATTTGGTTCTGCAGGGAAGCAGG + Intergenic
1084776430 11:71379979-71380001 TTCTGGTTCTACTGGGAAGCAGG + Intergenic
1084890772 11:72235893-72235915 CTCTGGTTCTTCAAATAACCTGG - Exonic
1084959189 11:72707356-72707378 CTCTGAGTCAGCAGAGAAGCTGG + Exonic
1085122179 11:73974333-73974355 CTCTTGTTGTGCAGATAAACAGG + Intergenic
1086208319 11:84286870-84286892 CTCTGCTTCTGCAGAGAGATGGG - Intronic
1090628995 11:128629864-128629886 CACTGGTTCCACATAGAAGCTGG + Intergenic
1091187940 11:133663311-133663333 ATGTGGGTCTGCAGAGAGGCTGG - Intergenic
1091215567 11:133899355-133899377 GGCTGGCTCTTCAGAGAAGCTGG + Intergenic
1092008543 12:5089226-5089248 CTGTGGTTGTGCAGAGCACCAGG - Intergenic
1092181596 12:6450527-6450549 CTCTGTTTTTCCAGAGATGCTGG + Exonic
1092259746 12:6946470-6946492 CTTTGGGGCTGCAGGGAAGCTGG + Intronic
1093147919 12:15588845-15588867 CTCTGCTTCTGCAGAAAAGTAGG - Intronic
1097188514 12:57208569-57208591 CTGTCCTTCTACAGAGAAGCAGG - Intronic
1097409877 12:59238825-59238847 CTCTGGTTCAGCAATGCAGCTGG + Intergenic
1097444152 12:59647626-59647648 TTCTGCTTCTGCAGTGAAGGTGG - Intronic
1100820154 12:98422591-98422613 GTCCGGTTCTTCACAGAAGCTGG - Intergenic
1100845223 12:98651566-98651588 CTCTGCTGCTGCAGCAAAGCTGG + Intronic
1103163008 12:118745895-118745917 CTCTTGGTCTGCAGAGATGTGGG + Intergenic
1103444783 12:120987521-120987543 TTCTGGTGCTGCAGGGAAACAGG + Intronic
1104474946 12:129063592-129063614 TGGTGGGTCTGCAGAGAAGCTGG - Intergenic
1105265196 13:18809050-18809072 ATCTGGGGCTGCAGAGCAGCTGG + Intergenic
1105891931 13:24688315-24688337 CTCTGGTGCTGGAGAGACCCTGG - Exonic
1106191210 13:27454262-27454284 GTCTGGTTCTGCAGTAGAGCTGG + Intergenic
1106542973 13:30706373-30706395 CTTGGGATCTGCAGAAAAGCTGG + Intergenic
1108409678 13:50133582-50133604 CTCTGGCGCAGCAGCGAAGCTGG + Intronic
1109564249 13:64090510-64090532 CTCTGCTTTTGCACAGTAGCTGG + Intergenic
1111041524 13:82756136-82756158 CTCTGATCCTGCAGAGAAGGAGG + Intergenic
1112243076 13:97701723-97701745 CTCTTGTTCTGTAGAGCACCTGG + Intergenic
1113486389 13:110655599-110655621 CGCTGCTTCAGGAGAGAAGCCGG + Intronic
1114313991 14:21493078-21493100 CTCTTGATCTGCAGAGGAGGAGG - Exonic
1116048334 14:39772608-39772630 CTCTGGTTCGACAGACAAGATGG - Intergenic
1116370228 14:44121406-44121428 CTCTGGCTGTGCAAAGAAGCAGG - Intergenic
1120502667 14:85316310-85316332 CCTTGGTTTTGCAGAGTAGCTGG - Intergenic
1121023349 14:90595930-90595952 CGCTTGTGCTGCAGGGAAGCAGG - Intronic
1121232053 14:92365294-92365316 GACTGGGTCTGCAGAGCAGCTGG + Intronic
1121275304 14:92663453-92663475 TTCTGGATCTGCAGAGATTCCGG - Intronic
1121787022 14:96669678-96669700 CTCTGGTTCTGTAGATAGCCAGG - Intergenic
1122293806 14:100693888-100693910 CTCAGGAGCTGCAGAGAAGGGGG - Intergenic
1122468997 14:101953387-101953409 CTCTGGTTCTGGAGGGATCCTGG - Intergenic
1124848923 15:33317233-33317255 CTCTGGTTTTACAGGAAAGCAGG - Intronic
1125391211 15:39195112-39195134 CTCTGGATCTGCAGACAAGCAGG - Intergenic
1125501916 15:40245189-40245211 CTCTGGGTGTCCAGGGAAGCAGG + Intronic
1126556235 15:49990720-49990742 CTATGATTTTCCAGAGAAGCTGG + Intronic
1127186746 15:56488349-56488371 CTATAGTTCAGAAGAGAAGCTGG + Intergenic
1128133940 15:65249097-65249119 CCATGTTTTTGCAGAGAAGCAGG - Intronic
1128525705 15:68410889-68410911 CTCTGACTCTGGGGAGAAGCAGG + Intronic
1130877767 15:88029112-88029134 CTCTGGTTCTTGAGAGCATCAGG - Intronic
1130898149 15:88186594-88186616 CTCTGGGGCTGCAGGAAAGCAGG - Intronic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132764031 16:1525451-1525473 CTCAGGGTCTGCAGAGCTGCAGG - Intronic
1134014580 16:10879303-10879325 GGCAGCTTCTGCAGAGAAGCCGG + Intronic
1138271862 16:55701460-55701482 CTCTGGCCCTGCAGGGAATCAGG - Intronic
1138939741 16:61775853-61775875 TTCTGGTTCTGTGGAGCAGCTGG - Intronic
1139123035 16:64043381-64043403 CTCTTGTACTGCAGCTAAGCTGG - Intergenic
1139340266 16:66263860-66263882 CTCTGGTATGGCAGGGAAGCCGG - Intergenic
1139505185 16:67395055-67395077 CTCTTTTTCTGCAGAGACACGGG + Exonic
1140007447 16:71092337-71092359 CTCTCTTCCAGCAGAGAAGCTGG - Intronic
1140132973 16:72180283-72180305 CTGTGGCTTTGCAGAAAAGCAGG - Intergenic
1140733082 16:77873970-77873992 CTCTGGTTCTGCAGAGAAGCAGG - Intronic
1141760089 16:86022570-86022592 CTCTCCCTCTGCAGAGAAGGAGG - Intergenic
1141861353 16:86718584-86718606 CCCGGGGTCTGCAGGGAAGCAGG - Intergenic
1143165723 17:4896414-4896436 CTCTGGATCTGGGGAGAAGGAGG - Exonic
1143930244 17:10415137-10415159 CTTTGGTACTACAGGGAAGCTGG - Exonic
1144330037 17:14214710-14214732 CTGAGGGTCTGCAGAGGAGCTGG - Intergenic
1145811627 17:27767679-27767701 CCCATGTGCTGCAGAGAAGCAGG + Intronic
1146261380 17:31424046-31424068 CTCTCTTTCTGATGAGAAGCCGG - Intronic
1147128938 17:38394499-38394521 GGCTGGTTCAGCAGAGAGGCTGG - Intronic
1147181883 17:38691578-38691600 CTCTGTTTTTGCTGAGAAGCTGG - Intergenic
1149019126 17:51943233-51943255 CTCTGGATTTCTAGAGAAGCTGG + Intronic
1149287972 17:55187172-55187194 AACTGGTTTTGCAGAGAAGTAGG + Intergenic
1149339440 17:55670623-55670645 CCCTCCTTCTGCAGAGAAGAGGG + Intergenic
1150135471 17:62692803-62692825 CTCGGGCTCTGCAAAGAAGGGGG - Exonic
1151336921 17:73445514-73445536 CTCTGGTTCTGAAGAGCATAGGG + Intronic
1151944023 17:77309559-77309581 ATGTGGATCTACAGAGAAGCTGG - Intronic
1152271002 17:79324834-79324856 CTCTGGGCAGGCAGAGAAGCAGG + Intronic
1152386899 17:79980116-79980138 TTCTGTTTCTGCAGAGCAGTGGG - Intronic
1152862250 17:82703221-82703243 CTCTGCTTCTGAAGGGAAGAGGG - Intergenic
1153487497 18:5614690-5614712 CTCTGGTTTCTCAGTGAAGCTGG - Intronic
1154162663 18:11991543-11991565 ATCAGGTTCTTCAGAGAAACAGG + Intronic
1154203630 18:12318525-12318547 CTATGGCTCTGCAGAGGGGCCGG - Intronic
1154423199 18:14252494-14252516 ATCTGGGGCTGCAGAGCAGCTGG - Intergenic
1156315913 18:35968520-35968542 CTGTGGTGGTGCAGAGAAGCGGG + Intergenic
1157471380 18:47991644-47991666 GTCTGGATCGGCAGAGGAGCAGG - Intergenic
1160235186 18:77080308-77080330 TTCTGATTCTGCAGAGAAAGGGG - Intronic
1162726896 19:12695256-12695278 CTCAGGCTCAGCATAGAAGCTGG + Intronic
1164843143 19:31409646-31409668 CTCTAGAGCTGCAGAAAAGCAGG + Intergenic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166344469 19:42156702-42156724 TTCAGGTTCTTCAGACAAGCCGG - Intronic
1166772449 19:45292025-45292047 CTCAGGTTCTGCATATAAGTTGG - Intronic
1167396496 19:49232919-49232941 GTAGGGTTGTGCAGAGAAGCAGG - Intergenic
925274462 2:2638802-2638824 CTTCATTTCTGCAGAGAAGCTGG + Intergenic
926202789 2:10813350-10813372 CTGGGGTTCTCCAGAGAAGGAGG - Intronic
926234562 2:11029530-11029552 CTCTGGTTCTGCAGAACAGAAGG - Intergenic
926699031 2:15790432-15790454 CCCTGGGACTGCAGTGAAGCAGG + Intergenic
927858288 2:26541048-26541070 CTTTGGTTATTCAGAGCAGCAGG - Intronic
928434586 2:31246301-31246323 CGCTGGAGCTGAAGAGAAGCAGG + Intronic
928944500 2:36760632-36760654 CTCTGGCTCTGCAGAGCCACAGG - Intronic
929468860 2:42170352-42170374 TTCTGGTTCTGCATACATGCTGG + Intronic
930052248 2:47225548-47225570 CCTGGGTTCTGCAGAGCAGCTGG + Intergenic
931424613 2:62159276-62159298 CTCTGGTGCAGCAAAGAAACTGG + Intergenic
931682940 2:64768066-64768088 CTCGGGTTCTGCAGAGGACCGGG - Intergenic
931833102 2:66072680-66072702 CCCTGTTGCTACAGAGAAGCAGG - Intergenic
932450837 2:71809786-71809808 GGCTGGAGCTGCAGAGAAGCAGG + Intergenic
935065588 2:99644644-99644666 CTGCGCGTCTGCAGAGAAGCTGG - Intronic
936621978 2:114109505-114109527 CTCTGGTTCTGAGGAGTAACAGG + Intergenic
938100457 2:128494497-128494519 CTATGGGTCTGCAGAGGTGCAGG + Intergenic
938310227 2:130284660-130284682 CTCTGGCCCAGCAGAAAAGCTGG - Intergenic
940838143 2:158548469-158548491 CCCTGTTGTTGCAGAGAAGCAGG + Intronic
940979470 2:159985358-159985380 CTCTGCCTGTGCAGAGATGCTGG + Intronic
941192198 2:162399003-162399025 CTCTGGTTCTACACAGCAGCAGG + Intronic
942756654 2:179349131-179349153 CTCTGCTTCTGGAGGGATGCTGG - Intergenic
943564210 2:189498386-189498408 CTCTGGCTGTGCAGACATGCAGG + Intergenic
943712784 2:191116272-191116294 ATATGATTCTGCAGAGAAGGTGG - Intronic
944579429 2:201118805-201118827 TTCTGGTTTTGCGGAGCAGCAGG + Intronic
944921383 2:204416650-204416672 CTCTGGACATGCATAGAAGCTGG - Intergenic
945254253 2:207790809-207790831 ATCTGATTCTGCAGAGCAGGGGG - Intergenic
947756756 2:232571606-232571628 CTCCACTCCTGCAGAGAAGCCGG - Intronic
948228700 2:236334126-236334148 CTCTGGATCTTCAGATGAGCAGG - Intronic
948372382 2:237497637-237497659 AATTGGTTCTGCAGAGGAGCTGG + Intronic
1169287731 20:4323541-4323563 CATTGGTTCTGCTGATAAGCAGG + Intergenic
1169669219 20:8076519-8076541 CTCTGGATCTCCTGGGAAGCAGG - Intergenic
1170905877 20:20514893-20514915 CTCTGCCTGTGCAGAGAACCAGG + Intronic
1171088889 20:22265768-22265790 GTCTGGCACTGCAGGGAAGCTGG + Intergenic
1171380688 20:24731833-24731855 CTCTGACTCTACAGGGAAGCAGG + Intergenic
1171886030 20:30652990-30653012 ATCTGGGGCTGCAGAGCAGCTGG + Intergenic
1172841238 20:37903623-37903645 CCCTGGCCCTGCAGAGAAGGGGG + Intronic
1173803770 20:45911243-45911265 CTCTGCTGCTTCAGTGAAGCAGG - Exonic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1175138393 20:56842074-56842096 AGCTGTTTCTGCAGAGAAGCTGG + Intergenic
1175329805 20:58155783-58155805 CTCTGCTTCTGCAGAGCAGGAGG - Intronic
1175403435 20:58713187-58713209 CTCTGGCTCTCCAGAGCAGCGGG + Intronic
1175921939 20:62454276-62454298 CTCCAGCTCTGCAGAGGAGCTGG - Intergenic
1176075494 20:63246460-63246482 CTCTGGTCCTGCAGGAAATCAGG - Intronic
1176850273 21:13907515-13907537 ATCTGGGGCTGCAGAGCAGCTGG + Intergenic
1177040860 21:16108755-16108777 TTCAGGTTCTGCAGATAAGGAGG + Intergenic
1177713283 21:24807543-24807565 CTGTGGGTCAGCAGAGAAGTAGG + Intergenic
1179070428 21:38065918-38065940 CTCTAAGTCTGCAGAGAGGCTGG - Intronic
1179657550 21:42854513-42854535 CTCCGGTTCTGCAGACCTGCAGG - Intronic
1179914136 21:44465288-44465310 CTCCTGTCCTGCAGGGAAGCAGG - Intergenic
1179982101 21:44900961-44900983 CGCTGGGACTGCAGGGAAGCAGG + Intronic
1180589128 22:16921329-16921351 CTCTGGGTCTGCAGAACAGGAGG - Intergenic
1180611813 22:17103316-17103338 CTCCGTTTCTGCATGGAAGCTGG - Intronic
1180949224 22:19713826-19713848 CTATGGGTCAGCAGAGAAGCAGG + Intergenic
1181730554 22:24843313-24843335 ATGTGTTTCTGCAGAGAAGGTGG + Intronic
1182073756 22:27480783-27480805 CGCTGGGTCTGCAGAGCAGCTGG + Intergenic
1182431646 22:30302374-30302396 TTCTGGTCCTGCAGGGAGGCAGG - Intronic
1183439935 22:37817461-37817483 CTCAGGGGCTGCAGAGTAGCGGG - Intergenic
1183539698 22:38422958-38422980 CCCTGGCTCTGCAGGGAAGCTGG + Intergenic
1184148044 22:42622938-42622960 CTCTGCTTTTCAAGAGAAGCTGG - Intronic
1184243288 22:43222735-43222757 TTCCGAGTCTGCAGAGAAGCCGG + Exonic
1184670940 22:46012050-46012072 CTCTGGGTCTCCCCAGAAGCCGG - Intergenic
949757102 3:7424699-7424721 CTCTGGCTCAGCACAGAAACTGG - Intronic
949880591 3:8657808-8657830 CTCTTGCTCAGCAGAGAACCAGG + Intronic
950070282 3:10146519-10146541 CTTTGGCTCTTCAGAGATGCAGG + Exonic
950148220 3:10666808-10666830 CCCAGGCTCTGCAGAAAAGCAGG - Intronic
950168345 3:10817877-10817899 CGCTGTATCTGCAGAGAGGCAGG - Intronic
950314796 3:11991803-11991825 CTCTGGGAATGCAGAGAAGGGGG + Intergenic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
952828381 3:37542922-37542944 CTCTGGGTCTGCAGTGATGCTGG + Intronic
952954580 3:38549188-38549210 CTCTGTGTCTGGAGAGGAGCTGG + Exonic
956843398 3:73160522-73160544 CTGTGATTCTGCAGACAATCAGG - Intergenic
958560517 3:95742953-95742975 CTCAGGTTGAGCAGAGCAGCAGG + Intergenic
959572053 3:107895296-107895318 CTCTGGTGCTGGGGTGAAGCAGG + Intergenic
961330061 3:126133185-126133207 CTCTGGGTATGCAAAGCAGCGGG - Intronic
961500507 3:127329731-127329753 CTCTGGTGGTACAGACAAGCAGG - Intergenic
962982654 3:140504778-140504800 CTCTGGCTCTGGAGAGAAGGTGG - Intronic
963043625 3:141086972-141086994 CACTGATTCTGCAGAGGAGCAGG + Intronic
963480824 3:145872035-145872057 GTCAGTTTCTGCAAAGAAGCTGG - Intergenic
964840284 3:160986163-160986185 CTCTATTTCTTCAAAGAAGCTGG - Intronic
967962112 3:194933755-194933777 TTCTGGTTCTGCAGGAAAACAGG - Intergenic
968394654 4:223737-223759 CTCTGGGGTTGCAGAGAAGAAGG + Intergenic
968407002 4:349660-349682 CTCTGGGGTTGCAGAGAAGAAGG + Intronic
968419234 4:468689-468711 CTCTGGGGTTGCAGAGAAGAAGG - Intronic
968733750 4:2284619-2284641 CTCTGGTTCCCCAGAGGAGTTGG + Intronic
969595723 4:8148362-8148384 CTCTGGGCCTACAGTGAAGCAGG + Intronic
971253067 4:24989310-24989332 CTCTGGCTCTGCAGAGTTTCTGG - Intergenic
971346629 4:25817481-25817503 CACTGGGCCTACAGAGAAGCTGG + Intronic
971944912 4:33261873-33261895 CTCTGGCTTCTCAGAGAAGCAGG - Intergenic
978287395 4:107095057-107095079 CCCTAGTCCTGCAGGGAAGCTGG + Intronic
979336653 4:119471190-119471212 CTTTGCTTCAGAAGAGAAGCAGG + Intergenic
981089995 4:140722356-140722378 ATCTGGTACTGCAGATAGGCAGG + Intronic
983239549 4:165216531-165216553 CTTTGCTTCAGAAGAGAAGCAGG + Intronic
984372143 4:178882188-178882210 CTAAGGTTGTGCAGAGCAGCAGG - Intergenic
985587213 5:746648-746670 CCCTTGTGCTGCAGAGAAGCTGG - Intronic
985601777 5:838816-838838 CCCTTGTGCTGCAGAGAAGCTGG - Intronic
985655236 5:1128274-1128296 CTCTTGTGCTGCAGATCAGCGGG - Intergenic
986019019 5:3783692-3783714 CAGTGGGTCTGCTGAGAAGCAGG + Intergenic
990995794 5:61731258-61731280 CTCTCTCTCTGCAAAGAAGCTGG - Intronic
991030918 5:62081528-62081550 CTCTTGTCCTGCAGAGGATCTGG - Intergenic
991034403 5:62113639-62113661 CTCTGATTCCTCAGAGAAGAAGG - Intergenic
991190546 5:63868150-63868172 CTCTGATTCTGCAGGTATGCAGG + Intergenic
992502449 5:77356038-77356060 CTCTGGTCCTGCACAGAAAAAGG + Intronic
992748004 5:79837830-79837852 CTCTGGCTCGGGACAGAAGCCGG - Intergenic
992794520 5:80243815-80243837 GTCTGGTTCTGGAGAGATCCAGG - Intronic
996271496 5:121610096-121610118 TTCATGTTCTGCAGAGGAGCAGG - Intergenic
997114939 5:131116328-131116350 CTCTGGCTCAGAAGAGAAGGGGG - Intergenic
997519256 5:134512186-134512208 CTCTAGGCCTGCAGGGAAGCTGG - Intergenic
998456401 5:142277143-142277165 GACTGGTGATGCAGAGAAGCAGG + Intergenic
1001796122 5:174503819-174503841 TCCTGGTGCTGTAGAGAAGCTGG - Intergenic
1003047647 6:2748652-2748674 CTCTCGTTCTGCACAGAGGAGGG + Intronic
1003117471 6:3292903-3292925 CTCTGTTGGTGAAGAGAAGCTGG - Intronic
1003642536 6:7887821-7887843 CTCTGGCCCTGCAGAAATGCCGG + Intronic
1003716963 6:8658343-8658365 TTCTGTTTCTGCAGGGATGCCGG + Intergenic
1004269239 6:14179303-14179325 CTCTGGCTCTGCAGAGGATGAGG - Intergenic
1004722077 6:18276699-18276721 CTCAGGTTCTGGAAAGAAGCAGG - Intergenic
1007724741 6:43908534-43908556 CTCTGGTTTTTCAAAGAAGATGG - Intergenic
1010033078 6:71289449-71289471 CTTTGCCTCTGCAGAGCAGCTGG + Intronic
1010317429 6:74467184-74467206 CCCTGGTTTTGCTGAGAACCAGG - Intergenic
1010610525 6:77949376-77949398 TTCTGGTTCTGAAGAGAAATAGG - Intergenic
1011257816 6:85441952-85441974 CTCTGGGTCTTCAGACCAGCTGG + Intergenic
1011650165 6:89498864-89498886 CTCACATTCTGCAAAGAAGCTGG - Intronic
1013267736 6:108516370-108516392 CTTTGGTTCTGTAGATATGCTGG - Intronic
1013805488 6:113991902-113991924 CTCTGCTTCTGCAGAAAACATGG + Intronic
1014292076 6:119570513-119570535 TTCTGGTTCTGCTGAAAAGGAGG + Intergenic
1015425479 6:133060829-133060851 CTCTGCTTCTGCACATAAACAGG - Intergenic
1016627512 6:146189724-146189746 CGCTGCTTCTGCAGAGAATGTGG - Intronic
1016841919 6:148533509-148533531 CCCTGGTTCTGCAGGGCAGGAGG + Intronic
1016844943 6:148560657-148560679 CACGGGTTCTGCTGAGAACCAGG - Intergenic
1020196930 7:6047781-6047803 CTCTGGTGCTGCTCAGTAGCAGG - Intronic
1020265246 7:6556243-6556265 GGCTGGTTCTGCAAAGAAGACGG - Intergenic
1022453927 7:30541339-30541361 CTCTGGTTCTGCTTATATGCTGG - Intronic
1024468708 7:49742912-49742934 CTTTTGTTCTGCAGAGAAGGTGG - Intergenic
1029153110 7:98495341-98495363 CTCTGTTTCTGATGGGAAGCTGG + Intergenic
1029487947 7:100854541-100854563 CCCTGGTTCTGCAGAGCTCCAGG - Intronic
1029696492 7:102217111-102217133 GTATGGATCTGCAGAAAAGCCGG + Intronic
1032219344 7:129982186-129982208 ATCAGGTTCTCCAGACAAGCTGG - Intergenic
1035331228 7:158098579-158098601 CTCTGGTTTCACAGAGCAGCTGG - Intronic
1036082907 8:5577174-5577196 CTCTGACTCTGCCCAGAAGCAGG - Intergenic
1036637203 8:10559545-10559567 CTCTAATTCTGCTGGGAAGCTGG - Intergenic
1036683793 8:10894863-10894885 AGCTGGTTTTGCAGAGATGCAGG - Intergenic
1036731394 8:11268756-11268778 CTCTGATTCTGTACAGAATCAGG - Intergenic
1037011596 8:13850320-13850342 TTCTGGTTCAGGAGAGAAGGGGG - Intergenic
1037802661 8:22043913-22043935 CACTGGATATGAAGAGAAGCGGG - Intronic
1038238026 8:25780865-25780887 CTCAGGCTCTGCAGTGAAACTGG + Intergenic
1039002276 8:32995035-32995057 CTGTTGTACTGCAGAGAAGCTGG + Intergenic
1039890250 8:41681064-41681086 CTCTGGGTCAGCACAGAACCAGG - Intronic
1041004732 8:53487126-53487148 GTCCAGTTCTGCACAGAAGCTGG - Intergenic
1041971702 8:63750576-63750598 CACTGGTTCTGCAGAGTTGGTGG + Intergenic
1044850640 8:96424178-96424200 TTCTGGTTTTGCATAGCAGCTGG + Intergenic
1048521732 8:135161783-135161805 TTCTGGTTATGCAGAGAACTTGG - Intergenic
1048583988 8:135755785-135755807 CTCAGGTTACCCAGAGAAGCAGG - Intergenic
1049110853 8:140642287-140642309 CGCTGCCTCTTCAGAGAAGCGGG - Intergenic
1049282479 8:141757140-141757162 CCATGGTGCTGCTGAGAAGCTGG - Intergenic
1049800452 8:144515234-144515256 ATCTGTGTCTGCAGAGACGCCGG - Exonic
1052004250 9:23327294-23327316 TTTTGGTTCTGCAGAGTAGATGG - Intergenic
1053304136 9:36972191-36972213 CCTGGGTTCTGCAGAGAAACTGG - Intronic
1053354126 9:37432168-37432190 CACTGGTCCTGCAGGGCAGCAGG - Intronic
1055581963 9:77715330-77715352 CCCTAGTTCTGCAGAGACACTGG - Intergenic
1057939281 9:99266754-99266776 CTGTGGTTTTGCAGACCAGCGGG - Intergenic
1058704362 9:107626475-107626497 CTCTGATTATCCAAAGAAGCTGG + Intergenic
1059341478 9:113599884-113599906 CTTTGGCTGTGCAGAGCAGCTGG + Intergenic
1059418692 9:114177808-114177830 TTCTGATTCTGCAGAGAATTTGG + Intronic
1060101778 9:120847057-120847079 CTCTGGGTGAGGAGAGAAGCAGG - Intergenic
1061890211 9:133615359-133615381 CTCTGGCTCCGCAGAGCGGCAGG - Intergenic
1062393923 9:136345023-136345045 CTCTGGATCTGCAGTGAGGCGGG + Intronic
1185474515 X:406610-406632 CGCTGTTTCTCCAGAGTAGCTGG + Intergenic
1185474536 X:406745-406767 CGCTGTTTCTCCAGAGTAGCTGG + Intergenic
1185474603 X:407199-407221 CGCTGTTTCTCCAGAGTAGCTGG + Intergenic
1185474688 X:407831-407853 CGCTGTTTCTCCAGAGTAGCTGG + Intergenic
1185474704 X:407962-407984 CGCTGTTTCTCCAGAGTAGCTGG + Intergenic
1185474762 X:408380-408402 CGCTGTTTCTCCAGAGTAGCTGG + Intergenic
1185678150 X:1865568-1865590 ATGTGGTTCTGCAGAAATGCAGG - Intergenic
1186317337 X:8385249-8385271 CTGTGGTTCAGCTGAAAAGCAGG - Intergenic
1192634756 X:72806536-72806558 CTCTGGTTCTTCAGAGGTCCAGG - Intronic
1192646957 X:72914265-72914287 CTCTGGTTCTTCAGAGGTCCAGG + Intronic
1193022088 X:76801800-76801822 GTCCAGTTCTGCACAGAAGCTGG - Intergenic
1193975520 X:88113755-88113777 CCCTGGGTCTCCAGAAAAGCAGG + Intergenic
1196579854 X:117366227-117366249 CTCAGATTCTGCAGAGATACTGG - Intergenic
1196655447 X:118212992-118213014 TGCTGCTCCTGCAGAGAAGCCGG + Intergenic
1199371126 X:147049470-147049492 CTCTAGTCCTGAGGAGAAGCAGG + Intergenic
1199790611 X:151151998-151152020 GTCTGGTACTGCAGAGATGGGGG - Intergenic
1200512758 Y:4100115-4100137 CGCTGGCTCAGCAGTGAAGCTGG - Intergenic