ID: 1140734787

View in Genome Browser
Species Human (GRCh38)
Location 16:77888682-77888704
Sequence CGCTGGCGGTACGGGAGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140734787_1140734799 25 Left 1140734787 16:77888682-77888704 CCTCTACTCCCGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1140734799 16:77888730-77888752 ATTGTCAAATGTCTCCTGGGTGG 0: 1
1: 36
2: 163
3: 376
4: 759
1140734787_1140734800 26 Left 1140734787 16:77888682-77888704 CCTCTACTCCCGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1140734800 16:77888731-77888753 TTGTCAAATGTCTCCTGGGTGGG 0: 1
1: 3
2: 21
3: 72
4: 344
1140734787_1140734798 22 Left 1140734787 16:77888682-77888704 CCTCTACTCCCGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1140734798 16:77888727-77888749 GACATTGTCAAATGTCTCCTGGG 0: 7
1: 132
2: 358
3: 796
4: 1201
1140734787_1140734797 21 Left 1140734787 16:77888682-77888704 CCTCTACTCCCGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1140734797 16:77888726-77888748 AGACATTGTCAAATGTCTCCTGG 0: 11
1: 139
2: 434
3: 873
4: 1455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140734787 Original CRISPR CGCTGGCGGTACGGGAGTAG AGG (reversed) Intronic
1064225812 10:13483819-13483841 TGCTGGGGGTACGGGAGGAAGGG + Intronic
1070605978 10:77898770-77898792 GGCAGGCGGTAAGGAAGTAGAGG + Intronic
1070670750 10:78375659-78375681 CGCTGGAGGGACGGGAGCAGGGG + Intergenic
1074843224 10:117375250-117375272 CGCTGTGGGCGCGGGAGTAGGGG - Exonic
1076027057 10:127124062-127124084 CGCTGGAGACAGGGGAGTAGAGG + Intronic
1081670382 11:44939062-44939084 TGCTGGCGGTGGGGGAGTGGGGG - Intronic
1086888099 11:92226121-92226143 CGCTGGCGGGGAGGCAGTAGAGG + Intergenic
1088823752 11:113476742-113476764 CTCTGGAGGCACGGGAGCAGAGG + Intergenic
1109676126 13:65677100-65677122 CACTGGTGGCATGGGAGTAGAGG + Intergenic
1113458830 13:110467677-110467699 CGCAGGCGGGACGGCAGTGGTGG - Intronic
1122454125 14:101836331-101836353 GGCTGGCAGGTCGGGAGTAGAGG - Intronic
1124949142 15:34300456-34300478 GGCTAGGGGTAGGGGAGTAGGGG - Intronic
1128408409 15:67367700-67367722 CACTGGTGGTACGGGGGTAGGGG + Intronic
1130912489 15:88280695-88280717 CACTGGGGGTATGGGAGTACTGG - Intergenic
1132601014 16:772967-772989 CGATCTCGGTGCGGGAGTAGAGG + Exonic
1138360800 16:56425578-56425600 CGCTGGCGGGACGGGCGCAGGGG + Intergenic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1141474177 16:84261051-84261073 CGCTGGGGGTCCCGGAGTCGAGG - Intergenic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1151746631 17:76015102-76015124 CGCTGGCGCTGCAGGAGGAGGGG + Exonic
1157622383 18:49024000-49024022 CGCAGGAGGTTCGGGAGGAGAGG - Intergenic
1163594302 19:18211871-18211893 CACTGGCGGTACAGGGGCAGCGG + Exonic
1167287010 19:48603910-48603932 AGCTGGGGGTCGGGGAGTAGGGG + Exonic
929604095 2:43224221-43224243 TGCTGGGGGCACGGGAGTGGGGG - Exonic
930993224 2:57685449-57685471 CTCAGGTGGTATGGGAGTAGTGG - Intergenic
946421949 2:219570358-219570380 CGGCGGCGGTCCGGGAGCAGCGG + Exonic
1169744444 20:8929054-8929076 GGCTGGCAGTAGGGGAGTAATGG + Intronic
1175816407 20:61885293-61885315 AGCTGGGGGTAAGGGAGTCGAGG - Intronic
950730069 3:14948539-14948561 CCCTGGCGGGGCGGGAGTAGAGG + Intronic
955359943 3:58265029-58265051 AGCTGGGGGTAGGGGAGAAGTGG - Intronic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
996543289 5:124651860-124651882 CGCTGGCCGTGCGGGGCTAGAGG + Intronic
997246207 5:132351596-132351618 TGCTGTTGGTAAGGGAGTAGGGG - Intergenic
1003342453 6:5234915-5234937 CTCTGGGGGTTTGGGAGTAGGGG - Intronic
1007257347 6:40538297-40538319 AGCTGGAGGCCCGGGAGTAGGGG - Intronic
1021106699 7:16646115-16646137 CGGGGGCGGTACGGGAGGCGGGG + Exonic
1022772225 7:33486031-33486053 TGTTGGCGGTGTGGGAGTAGGGG + Intronic
1028082742 7:86598949-86598971 CCCTGGAGGTGGGGGAGTAGGGG + Intergenic
1028987400 7:97018849-97018871 CGCTGGGGGTGCCGGAGGAGGGG + Intergenic
1036081948 8:5566966-5566988 CCCTGGCATTACAGGAGTAGGGG - Intergenic
1047752791 8:127894515-127894537 CACTGGCTGGACAGGAGTAGGGG - Intergenic
1048300066 8:133244965-133244987 CGCTGACGGCAAGGGAGCAGGGG + Intronic