ID: 1140734790

View in Genome Browser
Species Human (GRCh38)
Location 16:77888690-77888712
Sequence ATTGCCACCGCTGGCGGTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 20}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140734790_1140734803 29 Left 1140734790 16:77888690-77888712 CCCGTACCGCCAGCGGTGGCAAT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1140734803 16:77888742-77888764 CTCCTGGGTGGGACAAGGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 261
1140734790_1140734804 30 Left 1140734790 16:77888690-77888712 CCCGTACCGCCAGCGGTGGCAAT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1140734804 16:77888743-77888765 TCCTGGGTGGGACAAGGGTAGGG 0: 1
1: 0
2: 3
3: 33
4: 238
1140734790_1140734800 18 Left 1140734790 16:77888690-77888712 CCCGTACCGCCAGCGGTGGCAAT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1140734800 16:77888731-77888753 TTGTCAAATGTCTCCTGGGTGGG 0: 1
1: 3
2: 21
3: 72
4: 344
1140734790_1140734798 14 Left 1140734790 16:77888690-77888712 CCCGTACCGCCAGCGGTGGCAAT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1140734798 16:77888727-77888749 GACATTGTCAAATGTCTCCTGGG 0: 7
1: 132
2: 358
3: 796
4: 1201
1140734790_1140734799 17 Left 1140734790 16:77888690-77888712 CCCGTACCGCCAGCGGTGGCAAT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1140734799 16:77888730-77888752 ATTGTCAAATGTCTCCTGGGTGG 0: 1
1: 36
2: 163
3: 376
4: 759
1140734790_1140734801 24 Left 1140734790 16:77888690-77888712 CCCGTACCGCCAGCGGTGGCAAT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1140734801 16:77888737-77888759 AATGTCTCCTGGGTGGGACAAGG 0: 1
1: 0
2: 1
3: 17
4: 260
1140734790_1140734797 13 Left 1140734790 16:77888690-77888712 CCCGTACCGCCAGCGGTGGCAAT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1140734797 16:77888726-77888748 AGACATTGTCAAATGTCTCCTGG 0: 11
1: 139
2: 434
3: 873
4: 1455
1140734790_1140734802 25 Left 1140734790 16:77888690-77888712 CCCGTACCGCCAGCGGTGGCAAT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1140734802 16:77888738-77888760 ATGTCTCCTGGGTGGGACAAGGG 0: 1
1: 0
2: 1
3: 16
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140734790 Original CRISPR ATTGCCACCGCTGGCGGTAC GGG (reversed) Intronic
904338003 1:29810441-29810463 CTTGCCACAGCTGGCTGGACTGG - Intergenic
1064089016 10:12367711-12367733 AATGCCACCGCTGACTGAACGGG + Intronic
1075741262 10:124697861-124697883 ATTTCCACAGATGGCGGTAGAGG - Intronic
1088959800 11:114651539-114651561 ATTGCCACTGCTGGCTTTGCTGG + Intergenic
1107437367 13:40391939-40391961 ATTGTCACCACTGGCAGTAGAGG + Intergenic
1114579954 14:23748380-23748402 ATTCCCACCGCTGCCAGTCCTGG + Intergenic
1130941379 15:88512261-88512283 ATTGTCACAGCTGGAGGAACTGG - Intronic
1140734790 16:77888690-77888712 ATTGCCACCGCTGGCGGTACGGG - Intronic
1142741842 17:1936162-1936184 ATTGCCCCCGACGGCGGCACCGG - Exonic
941210986 2:162639062-162639084 GTTGCCACGGCTGGTGGTAGGGG - Intronic
1173372392 20:42448713-42448735 ATTCCCACCTCTGGCAGAACTGG - Intronic
969063362 4:4457053-4457075 AATGCCATAGCTGGCGCTACCGG - Intronic
977692652 4:99932959-99932981 ATTGCCAAAGCTGGGGGTGCAGG + Intronic
978406544 4:108385318-108385340 ACTGACACCGCTGGGGGTAGTGG - Intergenic
1008079708 6:47180962-47180984 GTTGCCACCACTGGGGGTAGAGG + Intergenic
1012429582 6:99150566-99150588 ATTGCCATCCATGGCGGTCCTGG - Intergenic
1035443310 7:158921864-158921886 GTTGCCACTGCTGGCCGTGCCGG - Intronic
1060563871 9:124571534-124571556 ATGGCCACTGCTGACGGGACTGG + Intronic
1185548662 X:966444-966466 GTTGCCACTGCTGAGGGTACAGG + Intergenic
1196419765 X:115509414-115509436 ATTGCCACTGCTGGCTGGAGTGG + Intergenic
1196419885 X:115510540-115510562 ATTGCCACTGCTGGCTGGAGTGG - Intergenic