ID: 1140734791

View in Genome Browser
Species Human (GRCh38)
Location 16:77888691-77888713
Sequence TATTGCCACCGCTGGCGGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140734791_1140734797 12 Left 1140734791 16:77888691-77888713 CCGTACCGCCAGCGGTGGCAATA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1140734797 16:77888726-77888748 AGACATTGTCAAATGTCTCCTGG 0: 11
1: 139
2: 434
3: 873
4: 1455
1140734791_1140734798 13 Left 1140734791 16:77888691-77888713 CCGTACCGCCAGCGGTGGCAATA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1140734798 16:77888727-77888749 GACATTGTCAAATGTCTCCTGGG 0: 7
1: 132
2: 358
3: 796
4: 1201
1140734791_1140734799 16 Left 1140734791 16:77888691-77888713 CCGTACCGCCAGCGGTGGCAATA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1140734799 16:77888730-77888752 ATTGTCAAATGTCTCCTGGGTGG 0: 1
1: 36
2: 163
3: 376
4: 759
1140734791_1140734803 28 Left 1140734791 16:77888691-77888713 CCGTACCGCCAGCGGTGGCAATA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1140734803 16:77888742-77888764 CTCCTGGGTGGGACAAGGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 261
1140734791_1140734801 23 Left 1140734791 16:77888691-77888713 CCGTACCGCCAGCGGTGGCAATA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1140734801 16:77888737-77888759 AATGTCTCCTGGGTGGGACAAGG 0: 1
1: 0
2: 1
3: 17
4: 260
1140734791_1140734802 24 Left 1140734791 16:77888691-77888713 CCGTACCGCCAGCGGTGGCAATA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1140734802 16:77888738-77888760 ATGTCTCCTGGGTGGGACAAGGG 0: 1
1: 0
2: 1
3: 16
4: 228
1140734791_1140734806 30 Left 1140734791 16:77888691-77888713 CCGTACCGCCAGCGGTGGCAATA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1140734806 16:77888744-77888766 CCTGGGTGGGACAAGGGTAGGGG 0: 1
1: 0
2: 4
3: 27
4: 343
1140734791_1140734804 29 Left 1140734791 16:77888691-77888713 CCGTACCGCCAGCGGTGGCAATA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1140734804 16:77888743-77888765 TCCTGGGTGGGACAAGGGTAGGG 0: 1
1: 0
2: 3
3: 33
4: 238
1140734791_1140734800 17 Left 1140734791 16:77888691-77888713 CCGTACCGCCAGCGGTGGCAATA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1140734800 16:77888731-77888753 TTGTCAAATGTCTCCTGGGTGGG 0: 1
1: 3
2: 21
3: 72
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140734791 Original CRISPR TATTGCCACCGCTGGCGGTA CGG (reversed) Intronic
901376789 1:8845302-8845324 TCCTGCCACCGCTGGCTGTGTGG - Intergenic
902927325 1:19704716-19704738 TATTACCACCGCTGGCCACAAGG - Intronic
907605717 1:55815439-55815461 TATTGCTACCACTGCTGGTAAGG + Intergenic
919427978 1:197457665-197457687 CATTCCCAGGGCTGGCGGTAGGG + Intronic
921908814 1:220526507-220526529 TATTGCGACGGCTGCCTGTAGGG - Intergenic
1064089015 10:12367710-12367732 TAATGCCACCGCTGACTGAACGG + Intronic
1083539475 11:63502452-63502474 TATTGCCACAGCCAGAGGTAGGG - Intergenic
1084568920 11:69948141-69948163 TATGGCCATCGCTGGCTGCAGGG - Intergenic
1096457881 12:51802309-51802331 TATTGCCACCACTGGGGGTGAGG + Intronic
1102900463 12:116632659-116632681 TATTGCCCAGGCTGGTGGTAAGG - Intergenic
1111440750 13:88280602-88280624 TGTTGCCACCACTGGGGGTGGGG - Intergenic
1128551830 15:68602670-68602692 TATTGCCCCCCCTTGAGGTAGGG + Intronic
1134014393 16:10878449-10878471 TCTTGCCACGGCTGGGGGTGTGG + Intronic
1140176999 16:72671988-72672010 TATTGCCAGGGGTGGCAGTAAGG + Intergenic
1140734791 16:77888691-77888713 TATTGCCACCGCTGGCGGTACGG - Intronic
935555075 2:104501069-104501091 TCTTGCCCCAGCTGGAGGTACGG + Intergenic
936838762 2:116742472-116742494 TGTTGCCACAGCTGGGGGAATGG - Intergenic
941210987 2:162639063-162639085 GGTTGCCACGGCTGGTGGTAGGG - Intronic
1178591110 21:33911119-33911141 TAGCGCCACCACTGGCAGTAAGG - Intronic
1182894795 22:33850206-33850228 TATTGCTGCTGCTGGTGGTAGGG - Intronic
1183700809 22:39449975-39449997 TGTGTCTACCGCTGGCGGTAGGG - Intergenic
953488077 3:43321754-43321776 TATGGGCACCTCTGGAGGTAAGG + Intronic
965127354 3:164648313-164648335 TGTTGCCACCACTGGGGATAAGG + Intergenic
974644951 4:64677382-64677404 TCTTGCCACCACTGGGGATAGGG + Intergenic
976826025 4:89261294-89261316 TATTGTCACAGCTGGAAGTAGGG - Intronic
976968163 4:91070736-91070758 TTTTTCCACCGCTGGGGGTGAGG - Intronic
978625489 4:110680369-110680391 CATTTCCACCTCTGGCAGTAGGG - Intergenic
1006255467 6:32829195-32829217 TACTGCCACAGCTGGAGGAATGG + Intronic
1006569677 6:34991832-34991854 TATTGCCAGCCCTGGAGGAAAGG + Intronic
1007579053 6:42944964-42944986 TATTACCAGAGCTGGCAGTAGGG - Intergenic
1009308303 6:62119698-62119720 TGTTGCCACCACTGGGGGCAGGG - Intronic
1009399384 6:63236462-63236484 TAATGCCACTGCTGACGGTCTGG + Intergenic
1011039712 6:83015871-83015893 CATTGCCACTACTGGGGGTAGGG + Intronic
1041162478 8:55059475-55059497 TACTGCCAACACTGGCGCTAGGG + Intergenic
1051273194 9:15374857-15374879 TATGGCCACTGTTGGGGGTAGGG - Intergenic
1052997661 9:34559746-34559768 TCCTGCCACCGCTGGGGGTGGGG + Intronic
1053393693 9:37753666-37753688 TACTCCCAGCCCTGGCGGTAGGG - Intronic
1056314585 9:85375555-85375577 TTTTGCCACCACTGGCGATGGGG + Intergenic
1061997554 9:134194177-134194199 TAATGCCACCCCAGGCGGGATGG + Intergenic
1197497819 X:127207583-127207605 TCTTGCCACCACTGGGGGTGGGG + Intergenic