ID: 1140734792

View in Genome Browser
Species Human (GRCh38)
Location 16:77888696-77888718
Sequence TTTTCTATTGCCACCGCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 79, 4: 248}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140734792_1140734804 24 Left 1140734792 16:77888696-77888718 CCGCCAGCGGTGGCAATAGAAAA 0: 1
1: 0
2: 1
3: 79
4: 248
Right 1140734804 16:77888743-77888765 TCCTGGGTGGGACAAGGGTAGGG 0: 1
1: 0
2: 3
3: 33
4: 238
1140734792_1140734806 25 Left 1140734792 16:77888696-77888718 CCGCCAGCGGTGGCAATAGAAAA 0: 1
1: 0
2: 1
3: 79
4: 248
Right 1140734806 16:77888744-77888766 CCTGGGTGGGACAAGGGTAGGGG 0: 1
1: 0
2: 4
3: 27
4: 343
1140734792_1140734797 7 Left 1140734792 16:77888696-77888718 CCGCCAGCGGTGGCAATAGAAAA 0: 1
1: 0
2: 1
3: 79
4: 248
Right 1140734797 16:77888726-77888748 AGACATTGTCAAATGTCTCCTGG 0: 11
1: 139
2: 434
3: 873
4: 1455
1140734792_1140734799 11 Left 1140734792 16:77888696-77888718 CCGCCAGCGGTGGCAATAGAAAA 0: 1
1: 0
2: 1
3: 79
4: 248
Right 1140734799 16:77888730-77888752 ATTGTCAAATGTCTCCTGGGTGG 0: 1
1: 36
2: 163
3: 376
4: 759
1140734792_1140734798 8 Left 1140734792 16:77888696-77888718 CCGCCAGCGGTGGCAATAGAAAA 0: 1
1: 0
2: 1
3: 79
4: 248
Right 1140734798 16:77888727-77888749 GACATTGTCAAATGTCTCCTGGG 0: 7
1: 132
2: 358
3: 796
4: 1201
1140734792_1140734803 23 Left 1140734792 16:77888696-77888718 CCGCCAGCGGTGGCAATAGAAAA 0: 1
1: 0
2: 1
3: 79
4: 248
Right 1140734803 16:77888742-77888764 CTCCTGGGTGGGACAAGGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 261
1140734792_1140734801 18 Left 1140734792 16:77888696-77888718 CCGCCAGCGGTGGCAATAGAAAA 0: 1
1: 0
2: 1
3: 79
4: 248
Right 1140734801 16:77888737-77888759 AATGTCTCCTGGGTGGGACAAGG 0: 1
1: 0
2: 1
3: 17
4: 260
1140734792_1140734800 12 Left 1140734792 16:77888696-77888718 CCGCCAGCGGTGGCAATAGAAAA 0: 1
1: 0
2: 1
3: 79
4: 248
Right 1140734800 16:77888731-77888753 TTGTCAAATGTCTCCTGGGTGGG 0: 1
1: 3
2: 21
3: 72
4: 344
1140734792_1140734802 19 Left 1140734792 16:77888696-77888718 CCGCCAGCGGTGGCAATAGAAAA 0: 1
1: 0
2: 1
3: 79
4: 248
Right 1140734802 16:77888738-77888760 ATGTCTCCTGGGTGGGACAAGGG 0: 1
1: 0
2: 1
3: 16
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140734792 Original CRISPR TTTTCTATTGCCACCGCTGG CGG (reversed) Intronic
901285604 1:8076308-8076330 TTTTCTATTGGCACAGCTGCTGG - Intergenic
902065709 1:13684689-13684711 TTTTCTGTTGCCCAGGCTGGAGG + Intergenic
902302030 1:15508803-15508825 TTTTCTATTGGCACAGCTGCTGG - Intronic
902848920 1:19137643-19137665 TTTACAAATGGCACCGCTGGAGG - Intronic
902868432 1:19296652-19296674 TTTCCTATTGCCAGAGCTGCTGG + Intergenic
905357422 1:37394611-37394633 TTTTCTGGTGCCCCCGCTTGTGG + Intergenic
907471904 1:54679617-54679639 TTTTCTCTTACCACCCCTGAAGG + Intronic
910070622 1:83208852-83208874 TTTTCTATTGGCACAGCTGCTGG + Intergenic
911011990 1:93289901-93289923 TTTTCTATTGGCACAGCTGTTGG + Intergenic
911957859 1:104261043-104261065 TTTCCTATTGGCACTGCTGCCGG - Intergenic
912819077 1:112852612-112852634 TTTCCTATTGCCACAACTGCTGG + Intergenic
916116395 1:161488378-161488400 TTTTCTATTGGCACAGCTGCTGG + Intergenic
917038171 1:170772640-170772662 TTTTTTATTGTCACAACTGGGGG - Intergenic
917860878 1:179142288-179142310 TTTTCTATTGCTACAGTTGCAGG + Intronic
918547123 1:185697661-185697683 TGTTCTATTGCCCATGCTGGAGG + Intergenic
918580948 1:186128359-186128381 TTTTCAATTTTCACAGCTGGAGG - Intronic
918868097 1:189929903-189929925 CTTTCTATTGGCACAGCTGCCGG + Intergenic
919354894 1:196509234-196509256 TTTTTTTTTGCCCCGGCTGGAGG - Intronic
922155201 1:223035608-223035630 TTTTCTATTGGCACAGCTGCCGG + Intergenic
922934429 1:229412337-229412359 TACTCTATTGCCCACGCTGGAGG + Intergenic
924031447 1:239889458-239889480 TTTTCTATTGGCACAGCTGCCGG + Intronic
1063697695 10:8352861-8352883 TTTTCTGCGGCCACCGCTGTTGG - Intergenic
1064137931 10:12766494-12766516 TTTTCTGTTGGCACAGCTGCTGG + Intronic
1064160724 10:12943489-12943511 TTTTCTATTGGCATAGCTGCTGG - Intronic
1064186805 10:13168990-13169012 TTTCCTATTGGCACAGCTGCAGG - Intronic
1064215967 10:13400878-13400900 TTTCCTATTGGCACAGCTGCCGG + Intergenic
1064773809 10:18753246-18753268 TTTCCTATTGACACAGCTGCTGG - Intergenic
1065006758 10:21387485-21387507 TTTTCTATGGGCACAGCTGTCGG - Intergenic
1065008881 10:21403986-21404008 TTTTCTATTGGCACAGTTGCTGG + Intergenic
1065439122 10:25731150-25731172 TCTTCTATTGGCACAGCTGCCGG + Intergenic
1065443739 10:25776116-25776138 TTTTCTGTTGGCACAGCTGCTGG + Intergenic
1066365889 10:34776756-34776778 TTTTCTTTTTCCACCAATGGTGG - Intronic
1066660473 10:37734660-37734682 TTTCCTATTGGCACAGCTGCTGG + Intergenic
1068306229 10:55212023-55212045 TTTTCTATTGGCACAGCTGCCGG - Intronic
1068505837 10:57898244-57898266 TTTTCTATTGGCACAGCTGCCGG - Intergenic
1069144607 10:64874513-64874535 TTTTTCATTGTCACAGCTGGAGG - Intergenic
1069484351 10:68811960-68811982 TGTTCTATTGCCCAGGCTGGAGG + Intergenic
1071418073 10:85459656-85459678 TTTTCTATTGGCACAGCTGCCGG - Intergenic
1071961695 10:90813691-90813713 TTTCCTATTGGCACAGCTGCTGG - Intronic
1072460124 10:95611068-95611090 TATTATATTGTCACAGCTGGAGG - Intronic
1074138741 10:110651875-110651897 TCTGCTATTGCCAGCGCAGGAGG - Intronic
1074418995 10:113292855-113292877 CTTTCTGTTGCCCCAGCTGGTGG + Intergenic
1077878000 11:6323700-6323722 TTTTCTATTGACACAGCTGCTGG + Intergenic
1078268388 11:9772305-9772327 TTTCCTATTGGCACAGCTGCTGG - Intergenic
1079542932 11:21597659-21597681 TTTTACATTGCCATTGCTGGTGG + Intergenic
1080449306 11:32365479-32365501 TTTCCTATTGTCACAGCTGCAGG + Intergenic
1080745297 11:35103370-35103392 ATTTCTATTGCCATCTCTGTTGG - Intergenic
1081363026 11:42203346-42203368 TTTTCTACTGGCACAGCTGCCGG - Intergenic
1083084666 11:60130198-60130220 TTTTCTATTGGCACAGCTGCTGG + Intergenic
1083104243 11:60342737-60342759 TTTTCTATTGGCACAACTGCTGG + Intronic
1085220385 11:74869490-74869512 TTTTCTATTGGCACAACTGCTGG - Intronic
1087438757 11:98156338-98156360 TTTTCTATTGGCACACCTGCTGG + Intergenic
1091363151 11:134994104-134994126 TTTTCTATTGGCACAGCTGCTGG + Intergenic
1092562762 12:9633537-9633559 TTTTCTATTGGCACAGCTGCTGG + Intergenic
1092732349 12:11546769-11546791 TTTCCTATTGGCACAGCTGCTGG + Intergenic
1092821515 12:12357425-12357447 TCTTCTGCTGCCACCGCTGTCGG + Exonic
1093188541 12:16049449-16049471 TTTTCTATTGACACAGCTGCCGG - Intergenic
1093738353 12:22651371-22651393 TTTTCTACTGGCACAGCTGCTGG + Intronic
1094399471 12:30045897-30045919 TTTTCCATTGCCCACCCTGGAGG - Intergenic
1094574117 12:31668210-31668232 TTTTCTATTTTAACCGCTGAAGG + Exonic
1094596616 12:31871984-31872006 TTTCCTATTGTCACAGCTGCCGG + Intergenic
1095831575 12:46592222-46592244 TTTTATATTGCCACCAATGATGG + Intergenic
1100815750 12:98385688-98385710 TTTTCTATTGGCATAGCTGCTGG - Intergenic
1102596499 12:113996806-113996828 TTTTTTATTATCACAGCTGGAGG - Intergenic
1103048100 12:117755202-117755224 TTTTCTTTTTACCCCGCTGGAGG - Intronic
1103236621 12:119378284-119378306 TTTCCTATTGACACAGCTGCTGG + Intronic
1103269578 12:119662061-119662083 TTTTCTATTGGCACAGCTGCTGG - Intergenic
1104181367 12:126385094-126385116 TTTTCTATTGGCACAACTGCCGG - Intergenic
1104575846 12:129965204-129965226 TTTTCTATTGGCACAGCTGCCGG + Intergenic
1104902338 12:132196334-132196356 TTGTCTGTGGCCACCGCTGCGGG - Intergenic
1105851008 13:24336649-24336671 TTCTCTGTTCCCACCTCTGGAGG - Intergenic
1106887525 13:34205634-34205656 TTTTCTATTGGCACAGCTGCTGG + Intergenic
1107271566 13:38624842-38624864 TTTTCGATTGGCACAGCTGCTGG - Intergenic
1107295695 13:38905077-38905099 TTTTCTTTTGGCACAGCTGCCGG - Intergenic
1108713597 13:53057638-53057660 TTTTCTATTGGCACAGCTGCCGG + Intergenic
1108950490 13:56086815-56086837 TCTTATATTGCCAGAGCTGGAGG - Intergenic
1109271621 13:60261905-60261927 TTTCCTATTGACACAGCTGCTGG + Intergenic
1111173682 13:84563820-84563842 TTTTCTATTGACACAGCTGCTGG + Intergenic
1111343536 13:86919069-86919091 TTTCCTATTGACACGGCTGCTGG + Intergenic
1111577522 13:90175870-90175892 TTTCCTATTGGCACCACTGCCGG - Intergenic
1112019790 13:95361777-95361799 TTTTCTATTGGCACAGTTGCTGG - Intergenic
1112260769 13:97876069-97876091 TTTTCTATTGGCACAGCTGCTGG - Intergenic
1115173432 14:30534515-30534537 TTTGATATTGCCATAGCTGGGGG + Intergenic
1116812584 14:49553923-49553945 TTTTCTATTTGCACAGCTGCCGG - Intergenic
1118095079 14:62527269-62527291 TTTTGTATTCCCACCAGTGGTGG - Intergenic
1118208903 14:63748866-63748888 TTTCCTATTGGCACAGCTGCTGG - Intergenic
1118865500 14:69700109-69700131 TTTTCTATTGGCACAGCTGCTGG + Intronic
1121262186 14:92574468-92574490 TTTTCTGTTGGCACAGCTGCCGG + Intronic
1122932396 14:104940284-104940306 CTTTCTAGTGCCACAGCAGGGGG - Exonic
1125816686 15:42591175-42591197 TTTTTTATTGTCACAGTTGGGGG - Intronic
1126416373 15:48421873-48421895 TTTTCTATTTCCTCTGCTGTTGG - Intronic
1127044182 15:55008708-55008730 TTATCTGTTGCCACTGCTGGAGG - Intergenic
1128459265 15:67853853-67853875 TTTTCTATTGGCACAGGTGCTGG + Intergenic
1128861083 15:71072773-71072795 TTTTCTATTGGCACAACTGCTGG + Intergenic
1130038877 15:80386957-80386979 TTTCCTATTGGCACAGCTGCCGG + Intronic
1130308421 15:82731143-82731165 TTTTCTATTGGCACAGCTGTCGG + Intergenic
1130772981 15:86943720-86943742 TTTTCTATTGGCACAGCTGCTGG + Intronic
1131645154 15:94333973-94333995 TCTTCTATTGCCACCTCTAAAGG - Intronic
1132955702 16:2592228-2592250 TTTTCTATGGTCACCCCTTGTGG + Intronic
1134001620 16:10787377-10787399 TTTCCTATTGGCACAGCTGTTGG - Intronic
1134002178 16:10791515-10791537 TTTCCTATTGGCACAGCTGCTGG - Intronic
1134129135 16:11636687-11636709 TTTCCTATTGGCACAGCTGCCGG + Intergenic
1135994938 16:27240623-27240645 TTTTCAATTGCCACCACTGATGG - Intronic
1136079701 16:27843820-27843842 TTATTCATTGCCACAGCTGGGGG - Intronic
1138748511 16:59391425-59391447 TTTTCTATTGGCACAGCTGCCGG + Intergenic
1138848077 16:60591620-60591642 TTTTCTATTGCTACTGCAGCAGG - Intergenic
1138898558 16:61240745-61240767 TTTCCTATTGGCACAGCTGCCGG - Intergenic
1138963215 16:62051869-62051891 TTTTCTATTGGCGCCGCTGCCGG + Intergenic
1139122490 16:64037244-64037266 TATTCTATTGGCACAGCTGCTGG + Intergenic
1140426731 16:74867436-74867458 TTTTTTATTGGCACAGCTGCCGG - Intergenic
1140542716 16:75773524-75773546 TATTCTGTTGCCCACGCTGGAGG + Intergenic
1140734792 16:77888696-77888718 TTTTCTATTGCCACCGCTGGCGG - Intronic
1142247877 16:88978036-88978058 TTTTCTGATGCCATGGCTGGAGG + Intergenic
1142510417 17:389391-389413 TTTTTTATTGTCACAGCTGGGGG - Intergenic
1145750524 17:27352481-27352503 TTCTCTTTTGCCACCTGTGGAGG - Intergenic
1146294866 17:31641571-31641593 TTTTCTATTGGCACGGCTGCCGG - Intergenic
1146540500 17:33689439-33689461 TTTTTGATTGACACCACTGGAGG - Intronic
1148943737 17:51239698-51239720 TTTTTGGTTGTCACCGCTGGGGG - Intronic
1149944400 17:60906037-60906059 TTTTCTATTGGCACAGCTGCTGG + Intronic
1150601489 17:66654710-66654732 TGTTCTGTTGGCACCACTGGGGG + Intronic
1151060013 17:71080977-71080999 TTTTCTGTTGGCACAGCTGCCGG - Intergenic
1153009802 18:528392-528414 TTTTTTATTGGCACAGCTGCTGG - Intergenic
1154300855 18:13191196-13191218 TTCACTCTTGCCACAGCTGGAGG + Intergenic
1155448896 18:25943041-25943063 TTTCCTATTGGCACAGCTGCTGG - Intergenic
1156428129 18:37038170-37038192 TTTTCTGTTGGCACAGCTGCTGG + Intronic
1157326740 18:46674592-46674614 TTTTGTATTGCCAGCACTGGCGG - Intronic
1157508658 18:48251552-48251574 TTTCCTATTGGCACAGCTGCTGG - Intronic
1159497992 18:69230641-69230663 TTTTCTATTGGCACAGCTGCCGG + Intergenic
1159676271 18:71287688-71287710 TTTTCTATTGGCACAGCTGCTGG - Intergenic
1159707194 18:71706515-71706537 TTTCCTATTGGCACAGCTGCTGG - Intergenic
1160600243 18:80007028-80007050 TTTTCTATTGGCACAGCTGCCGG + Intronic
1162864779 19:13537562-13537584 TTTCCTATTGGCACAGCTGCCGG - Intronic
1162880144 19:13652805-13652827 TTTTCTATTGGCACAGCTGCTGG - Intergenic
1163037132 19:14576795-14576817 TTTTCTATTGGCACAGCTGCTGG + Intergenic
1163047711 19:14656695-14656717 TTTCCTATTGGCACAGCTGCTGG + Intronic
1163057893 19:14735035-14735057 TTTCCTATTGGCACAGCTGCCGG + Exonic
1163060687 19:14759224-14759246 TTTCCTATTGGCACAGCTGCCGG + Intronic
1163215643 19:15875049-15875071 TTTTCTATTGGCACAGCTGCCGG - Intergenic
1163252842 19:16136616-16136638 TTTTCTATTGACGCAGCTGCTGG - Intronic
1163733717 19:18965593-18965615 TTTTCCATTGACACAGCTGCTGG - Intergenic
1164289963 19:23858668-23858690 TTTCCTATTGGCACAGCTGCTGG - Intergenic
1164763696 19:30746818-30746840 TTTCCTATTGTCACAGCTGCCGG + Intergenic
1165172488 19:33903795-33903817 TTTCCTATTGGCACAGCTGCTGG + Intergenic
1165530837 19:36399464-36399486 TTGTCTGTTGCCTCCTCTGGAGG - Intronic
1166426501 19:42683546-42683568 CTTTCTATTGGCACAGCTGCTGG + Intronic
1166654965 19:44604287-44604309 TATTCTATTGGCACAGCTGCCGG + Intergenic
1167812180 19:51843116-51843138 TTTTCTATTGCCACAATTTGTGG - Intergenic
1168444289 19:56398391-56398413 TTTCCTATTGGCACAGCTGCTGG + Intronic
1168446282 19:56417623-56417645 TTTTCTGCTGCCACCTCTGTTGG + Intronic
926410881 2:12601580-12601602 TTTTCTGTTGGCACAGCTGCTGG - Intergenic
928628987 2:33170863-33170885 TGTTCTACAGCCACCGCTGCTGG + Intronic
928926422 2:36584347-36584369 GTTTCTGTTGCCAGCCCTGGGGG + Intronic
932295375 2:70620047-70620069 TTTTCTATTGGCGCAGCTGCTGG - Intronic
935122061 2:100191729-100191751 TTTTCTACTGACCCAGCTGGAGG + Intergenic
935409985 2:102751474-102751496 TTTCCTATTGGCACAGCTGCTGG + Intronic
935456194 2:103270148-103270170 TTTTCTATTGTCACCACAGATGG + Intergenic
935897113 2:107749417-107749439 ATTTCAATTGCCGCCACTGGTGG - Intergenic
938713552 2:133997517-133997539 TTTTCTATTGGCAAAGCAGGAGG + Intergenic
939481216 2:142749047-142749069 TTTCCTATTGGCACAGCTGCAGG + Intergenic
940543680 2:155055090-155055112 TTTCCTATTGGTACCGCTGCTGG + Intergenic
940990363 2:160089678-160089700 TTTTCCATTGGCACAGCTGCCGG + Intergenic
940990373 2:160089807-160089829 TTTTCCATTGGCACAGCTGCTGG + Intergenic
940990382 2:160089935-160089957 TTTTCCATTGGCACAGCTGCTGG + Intergenic
941210989 2:162639068-162639090 TTTTTGGTTGCCACGGCTGGTGG - Intronic
943873193 2:193028005-193028027 TTTTCTATTGGCACAGCTGCTGG + Intergenic
944186474 2:196954327-196954349 TCTTCTATTGGCACAGCTGCTGG + Intergenic
945370513 2:209010717-209010739 TTTTGTAATGCCAACTCTGGTGG + Intergenic
946647287 2:221851452-221851474 TTTTCCATAGCCACCTCTTGAGG - Intergenic
946650390 2:221886966-221886988 TTTCCTAGTGCTACCTCTGGAGG + Intergenic
947522036 2:230853754-230853776 TTTTCAGTTGTCACAGCTGGAGG - Intergenic
948969224 2:241411662-241411684 TTTTCTATTCCCATCGCTGGGGG - Intronic
1169456053 20:5753577-5753599 TTTTCTAGTGGCACAGCTGCCGG - Intronic
1169469561 20:5872023-5872045 TCTTCTGTTGCCACTGCTGCAGG - Intergenic
1170449043 20:16462809-16462831 TTTGCTATTGGCACAGCTGCTGG - Intronic
1171133917 20:22679337-22679359 TTTGCTATTGTCACCTCTTGTGG - Intergenic
1171367598 20:24636685-24636707 TTTCCTATTGGCACAGCTGCTGG + Intronic
1175068948 20:56315870-56315892 TTTTCCACTTCCACAGCTGGGGG - Intergenic
1175642601 20:60643453-60643475 TTTTCAAACGCCACCGCTGATGG - Intergenic
1176974210 21:15300436-15300458 TTTTCTCATGCCACAGATGGTGG + Intergenic
1178323048 21:31620525-31620547 TTTTCTATTGGCACAGCTGCCGG + Intergenic
1178479644 21:32968433-32968455 TTTTCTATTGGCACAGCTGCCGG + Intergenic
1178529405 21:33362576-33362598 TTTCCTATTGGCACAGCTGCTGG + Intergenic
1180713221 22:17854201-17854223 TTTTCTGTTGACACAGCTTGGGG + Intronic
1181336204 22:22131733-22131755 TTTCCTATTGGCACAGCTGCTGG + Intergenic
1181425040 22:22830358-22830380 TTTTCTATTGGCATAGCTGCTGG - Intronic
1183602200 22:38846302-38846324 GTTCCTAATGCCACTGCTGGAGG + Intergenic
1183801961 22:40174194-40174216 TGCTCTATTGCCCCAGCTGGAGG + Intronic
1184579115 22:45401387-45401409 TTTTCTATTGGCTCAGCTGCCGG - Intronic
1184615151 22:45632975-45632997 TTTTCCATTGCCTGCTCTGGGGG - Intergenic
949091901 3:38785-38807 TTTTCTATTGGCACAGCTGCTGG + Intergenic
949233365 3:1777727-1777749 TTTCCTATTGGCACAGCTGCTGG - Intergenic
949609165 3:5686441-5686463 TTTCCTATTGGCACAGCTGCCGG + Intergenic
949801776 3:7912039-7912061 TTTTCTATTGGCACAGCTGCCGG - Intergenic
951354001 3:21641922-21641944 TTTTCTATTGGCGCAGCTGCTGG - Intronic
951827281 3:26882201-26882223 TGTTCTGTGGCCACCGCTGCTGG + Intergenic
952755015 3:36858253-36858275 TTTTTTATTGTCACAGCTAGGGG + Intronic
953839969 3:46382105-46382127 TTTCCTATTGGCACAGCTGCCGG - Intergenic
953840262 3:46384402-46384424 TTTCCTATTGGCACAGCTGCCGG + Intergenic
954932303 3:54294823-54294845 TTGGCTCTTGCCACTGCTGGTGG + Intronic
957032212 3:75255011-75255033 TTTTCTATTGGCACAGCTGCCGG + Intergenic
957243618 3:77690507-77690529 ATTTTCATTGCCACAGCTGGAGG - Intergenic
958651461 3:96941887-96941909 TGTTCTACAGCCACCGCTGCTGG - Intronic
958828779 3:99063955-99063977 TGTTCTACAGCCACCGCTGCTGG - Intergenic
959498819 3:107081594-107081616 TTTTGGATTGCCATGGCTGGGGG - Intergenic
960687623 3:120309973-120309995 TTTCCTATTGGCACAGCTGCCGG + Intergenic
960842255 3:121972114-121972136 TTTCCTATTGGCACGGCTGCTGG - Intergenic
961800933 3:129448628-129448650 TTTTCTATTGGCACAGCTGCCGG + Intronic
962374569 3:134849591-134849613 ATCTCTATTGCCAACTCTGGAGG + Intronic
963173887 3:142279117-142279139 TTTTCTATTGGCACAACTGCTGG - Intergenic
963174969 3:142288777-142288799 TTTTCTATTGGCACAACTGCTGG - Intergenic
964830391 3:160877930-160877952 TTTCCTATTGGCACAGCTGCAGG + Intronic
965446725 3:168782248-168782270 TTTTCTATTGTCAAAGCTGCTGG - Intergenic
966409501 3:179633706-179633728 TTTTCTATTGGCACAGCTACCGG + Intergenic
966630444 3:182068571-182068593 TTTCCCATTACCACAGCTGGAGG + Intergenic
966708690 3:182948085-182948107 TTTTTTATTGTCACCAGTGGGGG - Intronic
967515292 3:190361802-190361824 TTTTCTGTTGGCACAGCTGCTGG - Intronic
968678513 4:1899408-1899430 TTTTTTATTACCACCACTAGGGG - Intronic
968806808 4:2778875-2778897 TTTTCTATTGGCACAGCTGCTGG + Intergenic
972683345 4:41328088-41328110 TTTTCTACTGGCACAGCTGCCGG + Intergenic
973336467 4:48961635-48961657 TTTTCTATTGGAACAGCTGCTGG + Intergenic
975582988 4:75923464-75923486 TTTTCTGTTGGCACAGCTGCTGG - Intronic
975766201 4:77670354-77670376 TTTTCTATTGACACAGCTGTTGG - Intergenic
976732072 4:88273366-88273388 TTTTCTATTGGCACAGCTGCTGG - Intronic
978357433 4:107891906-107891928 TTTTGTATTGGCACAGCTGCTGG + Intronic
978395902 4:108279607-108279629 TTTTCTAAGGGCACTGCTGGTGG + Intergenic
980033052 4:127852736-127852758 TTTTCTGTTGGCACAGCTGCAGG - Intergenic
980161464 4:129168416-129168438 TTTTCTATTGGCATAGCTGCTGG + Intergenic
982413339 4:155104061-155104083 TTTTCTAATCCCACCCCTGAAGG - Intergenic
984046423 4:174805022-174805044 TTTTCTATTGGCACAGCTGTCGG + Intronic
986268558 5:6211486-6211508 TTTCCTATTGGCACAGCTGCTGG + Intergenic
986761130 5:10880974-10880996 TTTTCTATTCCCACGACAGGAGG - Intergenic
987135669 5:14897400-14897422 TTTTCTATTGGCACAGCAGCCGG + Intergenic
988775546 5:34475209-34475231 TTTTCTATTGGCATAGCTGCCGG - Intergenic
988943670 5:36172130-36172152 TTTTTTATTGTCACAGCTGTAGG + Intronic
988967244 5:36431956-36431978 TTTTCTGCTGCCACTGCTGCTGG - Intergenic
989189866 5:38660274-38660296 TTTCCTATTGGCACAGCTGCCGG - Intergenic
989240775 5:39201352-39201374 TTTTTGATTGCCACAACTGGAGG - Intronic
992071531 5:73153396-73153418 TTTTCTATTGGCACAGCTGCTGG + Intergenic
993398023 5:87414724-87414746 TTTGCTATTGCTACCACAGGAGG + Intergenic
995699603 5:114919561-114919583 TTTTCTACAGCCACCGCGGCTGG + Intergenic
997368858 5:133343291-133343313 CTTTCTGTTGGCACCGCTAGTGG - Intronic
998565591 5:143213407-143213429 TTGTCTATTCCCTCCCCTGGGGG + Intronic
999589560 5:153130300-153130322 TTTCCTATTGGCACAGCTGCTGG - Intergenic
1000886176 5:166750539-166750561 TTTTCTCTGGCAACTGCTGGAGG - Intergenic
1001370456 5:171194823-171194845 TTTTACATTTCCACCCCTGGAGG + Intronic
1003067583 6:2916891-2916913 TTTGCTAATGCCATCCCTGGTGG - Intergenic
1003694349 6:8388298-8388320 TTTTCTATTGGCGCGGCTGCCGG + Intergenic
1004073734 6:12326381-12326403 TTTTCTATTGGCACAGCTGCAGG - Intergenic
1004367221 6:15022408-15022430 TTTTTGATTGTCACAGCTGGGGG + Intergenic
1004569322 6:16830197-16830219 TCTTCTATGGGCACGGCTGGCGG + Intergenic
1005165644 6:22917032-22917054 TTTTCTATTGGCACAGCTGCTGG + Intergenic
1011775680 6:90728016-90728038 TTTTCTATTCTCACCATTGGGGG - Intergenic
1013211362 6:107989889-107989911 CTTTCTATTGGCACAGCTGCCGG - Intergenic
1013238079 6:108216348-108216370 TTTTTTATTGTCTCAGCTGGGGG - Intronic
1017780565 6:157712243-157712265 TTTCCTATTGGCACAGCTGCCGG - Intronic
1018007946 6:159640921-159640943 TTTTCTATTGGCGCAGCTGCTGG - Intergenic
1019903231 7:4040880-4040902 TTTTCTGTTGGCACAGCTGCCGG + Intronic
1019969783 7:4531271-4531293 TTTTCTATTGGCACAGCTGCTGG - Intergenic
1020784705 7:12558468-12558490 TTTCCTATTGGCACAGCTGCTGG + Intergenic
1022215781 7:28259564-28259586 TTTCCTATTGGCACAGCTGCTGG + Intergenic
1023278861 7:38548983-38549005 TTTTCTATTGGCACAGCTGCCGG + Intronic
1025153684 7:56584267-56584289 TTTCCTATTGGCACAGCTGCCGG - Intergenic
1025814003 7:64893013-64893035 TTTTCTATTGGCACAGCTGCCGG + Intronic
1026117620 7:67509235-67509257 TTTTCTATTGGCACAGCTGCCGG + Intergenic
1026276490 7:68882257-68882279 TTTTCTATTGGCACAGCTGCCGG - Intergenic
1027288342 7:76673715-76673737 TTTTCTATTGGCACAGCTGCTGG + Intergenic
1028104854 7:86865136-86865158 TTTTCTAAAGCCACATCTGGGGG + Intergenic
1029341004 7:99944574-99944596 TTTTCTATTGGCACAGCTGTTGG + Intergenic
1029585465 7:101467935-101467957 TTTTCTATTGGCACGGCTGCCGG + Intronic
1029585824 7:101470405-101470427 TTTTCTATTGGCATAGCTGCCGG + Intronic
1029602348 7:101575164-101575186 TTTTCTATTGGCACAGCTGTTGG - Intergenic
1030073083 7:105714230-105714252 TTCTCGATTGCCACCCCTGCAGG + Intronic
1030119876 7:106099248-106099270 TTTGCTTTTGCCACCTGTGGAGG - Exonic
1030258488 7:107538078-107538100 TTTTCTATTGACACAGCTGCTGG - Intronic
1031182701 7:118436980-118437002 TCTTCTATTGGCACAGCTGCTGG + Intergenic
1031356166 7:120789809-120789831 TTTTCTGTTGGCACAGCTGCTGG - Intronic
1031424162 7:121585538-121585560 TTTTCTATTGGCATAGCTGCTGG - Intergenic
1031549257 7:123088227-123088249 TTTTTTATTATCACAGCTGGAGG - Intergenic
1036388681 8:8305838-8305860 TTTTCTATGTCCAGAGCTGGGGG - Intergenic
1036425050 8:8637323-8637345 TTTTATATTGGCACAGCTGCTGG - Intergenic
1037032878 8:14130751-14130773 TTTTCTATTGGCACAGCTGCTGG - Intronic
1037216774 8:16464199-16464221 TTTTCTATTGGCACAGCTGTTGG - Intronic
1039117517 8:34108662-34108684 TTTTCTATTGGCACAGCTGCGGG + Intergenic
1039351818 8:36771758-36771780 TTTTCTATTGGCACAGCTGCTGG + Intergenic
1039849284 8:41348300-41348322 TTTTCTATTGGCACAGCTGCTGG + Intergenic
1039980594 8:42406784-42406806 TTTCCTATTGGCACAGCTGCTGG + Intergenic
1040027271 8:42793179-42793201 TTTCCTATTGGCACAGCTGCTGG + Intronic
1040779616 8:51092645-51092667 TTTTCTATTCACACAGCTGCTGG - Intergenic
1041492747 8:58452650-58452672 TTTTCTATTGGCACAGCTGCAGG + Intergenic
1042665132 8:71196010-71196032 TTTTCTATTGACACAACTGCTGG - Intergenic
1044003265 8:86911164-86911186 TTTTCTATTGGCACAGCTGTTGG + Intronic
1045324455 8:101107744-101107766 TTTTCTGTTGCCCAGGCTGGAGG - Intergenic
1045687037 8:104722933-104722955 TTTTTGCTTGCCACAGCTGGGGG - Intronic
1045777518 8:105822946-105822968 TTTCCTATTGGCACAGCTGCCGG + Intergenic
1046248900 8:111603816-111603838 TTTCCTATTGGCACAGCTGCTGG + Intergenic
1047356180 8:124124423-124124445 TTTTCTATTGGCATAGCTGCCGG - Intergenic
1050165499 9:2760808-2760830 TTTCCTATTGGCACAGCTGCAGG - Intronic
1051636878 9:19188817-19188839 TTTCCTATTGGCACAGCTGTTGG - Intergenic
1055443935 9:76364215-76364237 TTTTCTATTGGCACAGCTGCTGG - Intergenic
1055567864 9:77586890-77586912 TTTCCTATTGGCACAGCTGCAGG + Intronic
1056932632 9:90891492-90891514 TTTTCTATTGACACAGCTGCCGG + Intronic
1057497226 9:95570925-95570947 TCCTCTAGTGCCAACGCTGGAGG + Intergenic
1059111886 9:111565553-111565575 TGCTCTATTGCCAAGGCTGGAGG + Intronic
1185889055 X:3808267-3808289 TTTTCTATTGGCACAGCTGCCGG + Intergenic
1186016729 X:5204302-5204324 TTTCCTATTGGCACAGCTGCCGG - Intergenic
1186046073 X:5537714-5537736 TTTCCTATTGGCACAGCTGCCGG + Intergenic
1186063844 X:5740219-5740241 TTTCCTATTGGCACAGCTGCTGG + Intergenic
1186302372 X:8214147-8214169 TTTTCTATTGGCACAGCTGCTGG - Intergenic
1186444792 X:9618005-9618027 TTTTCAGTTGCCACAACTGGGGG - Intronic
1186648587 X:11534525-11534547 TTTTTGGTTGCCACTGCTGGAGG - Intronic
1187045509 X:15644648-15644670 ATTTTTATTGTCACAGCTGGAGG - Intronic
1188094619 X:26005822-26005844 TTTCCTATTGACACAGCTGCTGG + Intergenic
1188137930 X:26512667-26512689 TTTTCTATTGGCACAGCTGCTGG - Intergenic
1188159768 X:26784869-26784891 TTTCCTATTGTCACAGCTGCTGG + Intergenic
1188849650 X:35116141-35116163 TTTTCCATTGGCACAGCTGCCGG - Intergenic
1188964530 X:36535213-36535235 TTTCCTATTGGCACAGCTGCTGG + Intergenic
1189863728 X:45300984-45301006 TTTTCTATTGGCACAGCTGCTGG + Intergenic
1190681998 X:52834274-52834296 TGTTCTGTTGCCAAGGCTGGAGG + Intergenic
1193296022 X:79831358-79831380 TTTGCTATTGGCACAGCTGCTGG + Intergenic
1193328106 X:80206168-80206190 TTTTCTATTGGCACAGCTGCCGG - Intergenic
1194019001 X:88663981-88664003 TTTACTTTAGGCACCGCTGGTGG - Intergenic
1197271556 X:124429839-124429861 TTTTCAGTTGCCACAACTGGGGG - Intronic
1197917684 X:131553529-131553551 TGTTCTACAGCCACCGCTGCTGG + Intergenic
1200773009 Y:7144678-7144700 TTTTCTATTGGCACAGCTGCCGG - Intergenic
1201408060 Y:13668856-13668878 TTTTCTATTGGCACAGCTGCTGG - Intergenic
1201860186 Y:18589053-18589075 TTTGCTATTGCCACCTCAGCTGG - Intergenic
1201873135 Y:18731328-18731350 TTTGCTATTGCCACCTCAGCTGG + Intergenic
1201925561 Y:19283541-19283563 TTTTCTTTTGACACAGCTGCTGG - Intergenic
1201973286 Y:19818747-19818769 TTTTCTATTGGCACAGCTGCTGG + Intergenic