ID: 1140734793

View in Genome Browser
Species Human (GRCh38)
Location 16:77888699-77888721
Sequence ACATTTTCTATTGCCACCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 173}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140734793_1140734800 9 Left 1140734793 16:77888699-77888721 CCAGCGGTGGCAATAGAAAATGT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1140734800 16:77888731-77888753 TTGTCAAATGTCTCCTGGGTGGG 0: 1
1: 3
2: 21
3: 72
4: 344
1140734793_1140734804 21 Left 1140734793 16:77888699-77888721 CCAGCGGTGGCAATAGAAAATGT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1140734804 16:77888743-77888765 TCCTGGGTGGGACAAGGGTAGGG 0: 1
1: 0
2: 3
3: 33
4: 238
1140734793_1140734806 22 Left 1140734793 16:77888699-77888721 CCAGCGGTGGCAATAGAAAATGT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1140734806 16:77888744-77888766 CCTGGGTGGGACAAGGGTAGGGG 0: 1
1: 0
2: 4
3: 27
4: 343
1140734793_1140734797 4 Left 1140734793 16:77888699-77888721 CCAGCGGTGGCAATAGAAAATGT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1140734797 16:77888726-77888748 AGACATTGTCAAATGTCTCCTGG 0: 11
1: 139
2: 434
3: 873
4: 1455
1140734793_1140734803 20 Left 1140734793 16:77888699-77888721 CCAGCGGTGGCAATAGAAAATGT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1140734803 16:77888742-77888764 CTCCTGGGTGGGACAAGGGTAGG 0: 1
1: 0
2: 0
3: 27
4: 261
1140734793_1140734802 16 Left 1140734793 16:77888699-77888721 CCAGCGGTGGCAATAGAAAATGT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1140734802 16:77888738-77888760 ATGTCTCCTGGGTGGGACAAGGG 0: 1
1: 0
2: 1
3: 16
4: 228
1140734793_1140734799 8 Left 1140734793 16:77888699-77888721 CCAGCGGTGGCAATAGAAAATGT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1140734799 16:77888730-77888752 ATTGTCAAATGTCTCCTGGGTGG 0: 1
1: 36
2: 163
3: 376
4: 759
1140734793_1140734801 15 Left 1140734793 16:77888699-77888721 CCAGCGGTGGCAATAGAAAATGT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1140734801 16:77888737-77888759 AATGTCTCCTGGGTGGGACAAGG 0: 1
1: 0
2: 1
3: 17
4: 260
1140734793_1140734798 5 Left 1140734793 16:77888699-77888721 CCAGCGGTGGCAATAGAAAATGT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1140734798 16:77888727-77888749 GACATTGTCAAATGTCTCCTGGG 0: 7
1: 132
2: 358
3: 796
4: 1201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140734793 Original CRISPR ACATTTTCTATTGCCACCGC TGG (reversed) Intronic
902261704 1:15230111-15230133 ACATTTTTGATTGCCACACCTGG - Intergenic
904456680 1:30651962-30651984 ACATTTTCAGTTGTCACAGCTGG - Intergenic
908241693 1:62194142-62194164 ACAGTCTCTGTTGCCACAGCTGG - Intergenic
911175946 1:94818986-94819008 ACATTTTCTACTGCCTCTGGAGG + Intergenic
911254229 1:95615666-95615688 AGAATTTCTATTGCAACAGCAGG - Intergenic
917038174 1:170772643-170772665 ACATTTTTTATTGTCACAACTGG - Intergenic
918853393 1:189720215-189720237 ACATTTTCAATTGTCACAGAAGG + Intergenic
923295326 1:232589403-232589425 ACATTGTCTTTTGCCACCATTGG + Intergenic
923329842 1:232912762-232912784 ACATTTTCTATCTCCTCTGCAGG - Intergenic
1065039326 10:21675391-21675413 ACATTTTTTATTCCCACTGTAGG - Intronic
1069011535 10:63378922-63378944 AAATTTTCTATTGAAACTGCAGG + Intronic
1069144608 10:64874516-64874538 ACATTTTTCATTGTCACAGCTGG - Intergenic
1070666622 10:78349591-78349613 ACATTTTTGATTGTCACAGCTGG + Intergenic
1071714217 10:88078844-88078866 ACATTTTTGATTGTCACAGCTGG - Intergenic
1072754117 10:98006758-98006780 GCATTTACTTTTGCCACCCCTGG - Intronic
1074146318 10:110720421-110720443 ACATTTTGCAGTGCAACCGCGGG + Intronic
1074763434 10:116684158-116684180 ACATTTTCTTTGGCCACCCTGGG - Intronic
1075071441 10:119322372-119322394 ACATTTTTAATTGTCACCACTGG - Intronic
1075556025 10:123433142-123433164 ACATTTACTATTTCCACAGGAGG + Intergenic
1082329325 11:51191425-51191447 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082344556 11:51412951-51412973 AGATTTTCCATTTCCACCACAGG - Intergenic
1082360736 11:51648274-51648296 AGATTTTCTTTTTCCACCACAGG - Intergenic
1082364462 11:51702676-51702698 AGATTTTCCATTTCCACCACAGG - Intergenic
1082366167 11:51727332-51727354 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082380464 11:51934749-51934771 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082381455 11:51949326-51949348 AGATTTTCCATTTCCACCACAGG - Intergenic
1082388107 11:52046239-52046261 ACATTTTCCTTTTCCACCACAGG - Intergenic
1082392404 11:52109145-52109167 ACATTTTCCTTTTCCACCACAGG - Intergenic
1082393694 11:52127849-52127871 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082399404 11:52210445-52210467 ACATTTTCCTTTTCCACCACAGG - Intergenic
1082408619 11:52343714-52343736 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082410940 11:52377068-52377090 AGATTTTCCATTTCCACCACAGG - Intergenic
1082418889 11:52491828-52491850 ACATTTTCCTTTTCCACCACAGG - Intergenic
1082422230 11:52540285-52540307 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082422349 11:52541985-52542007 AGATTTTCCATTTCCACCACAGG - Intergenic
1082428608 11:52632944-52632966 AGATTTTCCATTTCCACCACAGG - Intergenic
1082430388 11:52658421-52658443 ACATTTTCCTTTTCCACCACAGG - Intergenic
1082434935 11:52723879-52723901 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082438113 11:52769779-52769801 AGATTTTCCATTTCCACCACAGG - Intergenic
1082439161 11:52785082-52785104 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082444247 11:52858153-52858175 AGATTTTCCTTTGCCACCACAGG - Intergenic
1082450628 11:52950821-52950843 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082460387 11:53092784-53092806 AGATTTTCCATTTCCACCACAGG - Intergenic
1082466186 11:53176092-53176114 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082470840 11:53243466-53243488 AGATTTTCCATTTCCACCACAGG - Intergenic
1082471411 11:53251970-53251992 AGATTTTCTTTTTCCACCACAGG - Intergenic
1082478560 11:53355682-53355704 ACATTTTCCTTTTCCACCACAGG - Intergenic
1082486968 11:53476397-53476419 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082488379 11:53496801-53496823 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082489096 11:53507005-53507027 AGATTTTCCATTTCCACCACAGG - Intergenic
1082492246 11:53551655-53551677 ACATTTTCCTTTTCCACCACAGG - Intergenic
1082509862 11:53807211-53807233 ACATTTTCCTTTTCCACCACAGG - Intergenic
1082515428 11:53887145-53887167 ACATTTTCCTTTTCCACCACAGG - Intergenic
1082516777 11:53906697-53906719 AGATTTTCCATTTCCACCACAGG - Intergenic
1082528826 11:54081153-54081175 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082529599 11:54092209-54092231 AGATTTTCTTTTTCCACCACAGG - Intergenic
1082530651 11:54107522-54107544 AGATTTTCTTTTTCCACCACAGG - Intergenic
1082533578 11:54150034-54150056 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082535207 11:54173836-54173858 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082540400 11:54248829-54248851 AGATTTTCCTTTTCCACCGCAGG - Intergenic
1082542691 11:54281990-54282012 ACATTTTCCTTTTCCACCACAGG - Intergenic
1089028428 11:115296258-115296280 ACATTTTCTATTAGCCCCACTGG + Intronic
1089898325 11:121955039-121955061 ACATTTTCTCTTGCTATCTCTGG - Intergenic
1102596500 12:113996809-113996831 ACATTTTTTATTATCACAGCTGG - Intergenic
1104089176 12:125500407-125500429 ACATTTTCAGTTGTCACCCCAGG - Intronic
1106070466 13:26406583-26406605 GCATTTTCTATTCCCTCCCCCGG + Intergenic
1107055406 13:36098273-36098295 ACATTTTCTGTTACAACAGCTGG - Intronic
1107729695 13:43336167-43336189 ACATTTTTTATTTCCACCAAGGG - Intronic
1116660047 14:47698658-47698680 ACATTTTCTTTTTCCACCATTGG - Intergenic
1121599596 14:95193415-95193437 CCATTCTCTGTTGCCACTGCAGG - Intronic
1121902834 14:97709416-97709438 ATATTTTCTATTGCCCTAGCTGG + Intergenic
1122029788 14:98903735-98903757 ACATTTTGTATTTCCACCCTGGG + Intergenic
1123970975 15:25507602-25507624 ACCATTTCTATTGCCACCCGTGG - Intergenic
1130831653 15:87607326-87607348 ACTTTTTCTACTCCCACAGCTGG - Intergenic
1130898377 15:88188365-88188387 ACATTTTTGATTGTCACAGCTGG + Intronic
1130980445 15:88808598-88808620 ACATTTTTTGTTGTCACCACTGG + Intronic
1131530161 15:93184051-93184073 ACATTTTTTATTGTCACAGCTGG - Intergenic
1132722759 16:1324917-1324939 CCATCTTCCATTGCCGCCGCGGG + Exonic
1134304644 16:13021215-13021237 ACATTTTTTATTGTTACCACTGG + Intronic
1134671834 16:16061464-16061486 CCATTTTCTATTGTCACCACTGG - Intronic
1134819073 16:17230855-17230877 ACATTTTTCATTGCCACAACTGG + Intronic
1138621549 16:58215371-58215393 ACATTTTTTATTGTCACCAATGG + Intergenic
1140734793 16:77888699-77888721 ACATTTTCTATTGCCACCGCTGG - Intronic
1141022498 16:80510681-80510703 ACATTTTTGATTGTTACCGCTGG - Intergenic
1141249425 16:82341604-82341626 GCATTATCTATTGCCATTGCAGG + Intergenic
1141517510 16:84555744-84555766 GCATTTGCTTTTGCCACCCCTGG - Intergenic
1142312900 16:89324158-89324180 ACATTTTCTGTTATCACGGCGGG + Intronic
1142510420 17:389394-389416 ACATTTTTTATTGTCACAGCTGG - Intergenic
1142908134 17:3062474-3062496 ACATTATTTATTGCCAAGGCTGG + Intergenic
1142926430 17:3241787-3241809 ACATTATTTATTGCCAAGGCTGG - Intergenic
1144255134 17:13460237-13460259 ACATTTTCTTTTTCCATCACTGG + Intergenic
1146540501 17:33689442-33689464 ACATTTTTGATTGACACCACTGG - Intronic
1154318250 18:13323445-13323467 ACATTTGCTATTTCCAGCTCAGG - Intronic
1157316189 18:46592012-46592034 ACAACTTCAATTGCAACCGCTGG - Intronic
1157326741 18:46674595-46674617 TCATTTTGTATTGCCAGCACTGG - Intronic
931601289 2:64005697-64005719 ACATTTTTGATTGTCACAGCTGG - Intronic
932179398 2:69632332-69632354 ACATTTTTCATTGCCACAGTAGG + Intronic
932690339 2:73907757-73907779 ACATTTTTTATTGTCACAACTGG + Intronic
936738956 2:115480599-115480621 ACATTTGCTCTTGGCACAGCTGG - Intronic
939903491 2:147880343-147880365 ACATTTTTTAATGCCAACTCAGG + Intronic
941102796 2:161315165-161315187 ACATTTTTGATTGTCACAGCTGG + Intronic
943715679 2:191150258-191150280 ACATTTTCTATTGCAGCCTCTGG + Intronic
945417425 2:209591262-209591284 ACATTTTGGATTGTCACCACTGG + Intronic
948204731 2:236157314-236157336 CCATTTTCTATGACCACAGCTGG - Intergenic
1170787862 20:19483032-19483054 ACACTTTCTATCTCCACTGCAGG + Intronic
1174828077 20:53787100-53787122 ACATTTTCCATTGTCACAGCAGG - Intergenic
1179436707 21:41367357-41367379 ACATTTTCTTTTGACACTCCTGG + Intronic
1179602383 21:42488719-42488741 GCATTTTGTAATGCCACCACAGG + Intronic
1182595889 22:31420011-31420033 ACATTTTCTGTTGCCCAGGCTGG - Intronic
950692070 3:14667058-14667080 ATATTTTCTATTTCCAAAGCAGG - Intronic
951642787 3:24854768-24854790 ACATTTTTTATTGGTACAGCTGG - Intergenic
955784922 3:62527395-62527417 ATATTTTTGATTGCCACAGCTGG - Intronic
958091246 3:88879548-88879570 ACATTTTCTATTCCCTTTGCCGG - Intergenic
958827585 3:99050164-99050186 ACATTTTTTGTTGCCACAACTGG - Intergenic
958877874 3:99636905-99636927 ACATTTTTTATTTTCACAGCTGG + Intergenic
959382560 3:105659124-105659146 ACATTTTCCAATGCCGCCTCAGG + Exonic
959498822 3:107081597-107081619 ACATTTTGGATTGCCATGGCTGG - Intergenic
960375065 3:116890519-116890541 ACATTCTCTATTTCCACACCAGG + Intronic
962613218 3:137098654-137098676 GCATTTTCATTTGCCACCACTGG + Intergenic
963665751 3:148183961-148183983 ACATTTTTGGTTGCCACAGCTGG - Intergenic
964110176 3:153079332-153079354 GCAGTTTCTAGTGCCTCCGCAGG - Intergenic
966708693 3:182948088-182948110 ACATTTTTTATTGTCACCAGTGG - Intronic
970723713 4:19017625-19017647 ACATTTTTGGTTGCCACAGCTGG - Intergenic
971660730 4:29411479-29411501 ACATTTTCCATTGATACCTCTGG - Intergenic
971931101 4:33084283-33084305 ACATTTTCTAGAGGCACTGCAGG - Intergenic
972302060 4:37793699-37793721 ACATTTTTGGTTGCCACCACTGG + Intergenic
972547843 4:40097965-40097987 ACATTTTTTATTGTCACAACTGG - Intronic
974816526 4:67011807-67011829 GCATTTTCTATTCCCACCAATGG - Intergenic
976826027 4:89261302-89261324 ACATTTTTTATTGTCACAGCTGG - Intronic
978114834 4:105006507-105006529 ACATTTTTGATTGTCACCACTGG + Intergenic
981200447 4:141973311-141973333 AAATTTTCTATTGCATCCTCAGG + Intergenic
987903816 5:24050347-24050369 ACATTTCCTTTGGCCACCTCAGG - Intronic
987966127 5:24877017-24877039 ACATTTTATATTACCACAGTAGG - Intergenic
988476219 5:31588254-31588276 CCCTTTTCTATTGGCACAGCTGG + Intergenic
989889928 5:46958881-46958903 ACATATTCTTTTTCCACCACAGG - Intergenic
994104088 5:95926256-95926278 ACTTTTTCTATTGCCAGTGAAGG - Intronic
994933905 5:106226718-106226740 TTATTTTCTATTGCCACAGATGG - Intergenic
997926714 5:138036900-138036922 ACATTTTTGATTGTCACCACTGG + Intronic
998488696 5:142526828-142526850 ACATTTTCTATTGCCCAGGCTGG - Intergenic
999209462 5:149875196-149875218 ACATTTTTGATTGTCACAGCTGG + Intronic
1000326599 5:160177100-160177122 AAATTTGCTATGGCCACCACCGG - Intergenic
1000750670 5:165092333-165092355 ACATTTTCTGTTGCTACAACAGG + Intergenic
1001171170 5:169420140-169420162 ACCTTCTCTATTGCCACCTTGGG + Intergenic
1001237188 5:170039975-170039997 ACATTCTCTCCTGCCACCGTTGG - Intronic
1003279528 6:4679409-4679431 ACATTTTTGGTTGCCACAGCTGG + Intergenic
1003553469 6:7119864-7119886 CCTTTTTCTACTGCCACCACCGG - Intronic
1004073336 6:12322312-12322334 ACATTTTTTATTGTTACAGCTGG + Intergenic
1004324995 6:14666356-14666378 GCATTTTCTTTTGCCTCCTCTGG + Intergenic
1004608317 6:17214728-17214750 ACATTTTTGATTGTCACAGCTGG + Intergenic
1010688190 6:78876801-78876823 ACATTTTTTATTGTCACAGCTGG - Intronic
1011637794 6:89390555-89390577 ACATTTTGTATTCCCACCAGTGG - Intronic
1013238082 6:108216351-108216373 ACATTTTTTATTGTCTCAGCTGG - Intronic
1014950751 6:127552062-127552084 ACATTTTCTACTGTCACAACTGG - Intronic
1016323066 6:142869063-142869085 ACATTTTTTATTGTCACAACTGG + Intronic
1018729605 6:166638739-166638761 ACATTTTTGATTGTCACAGCTGG + Intronic
1020489611 7:8764024-8764046 ACATTTTATATTCCCACCAATGG + Intergenic
1022555674 7:31293309-31293331 GCATTTGGTATTGCCACTGCAGG + Intergenic
1032847352 7:135762886-135762908 ACATTTTTGATTGACACAGCTGG - Intergenic
1034708480 7:153170015-153170037 CCATCTGCTATTGCCACAGCTGG - Intergenic
1036182917 8:6600449-6600471 ACATTTACCATTGCCACCACTGG + Intronic
1038862764 8:31405365-31405387 ACATTTTTGATTGTCACAGCCGG + Intergenic
1041672472 8:60505561-60505583 AGATTCTCTATTGCCAGCTCTGG + Intergenic
1043351561 8:79367368-79367390 ACATTTTCTATTATCACCCCTGG - Intergenic
1043644613 8:82501134-82501156 ACATTTTCAATTCCCCCTGCTGG - Intergenic
1045458692 8:102407984-102408006 ACATTTTTTATTGTCACAGCTGG - Intronic
1045687040 8:104722936-104722958 ACATTTTTGCTTGCCACAGCTGG - Intronic
1046611383 8:116429454-116429476 ACATCTTCCATGGCCACAGCAGG + Intergenic
1048375840 8:133821844-133821866 ACATCTTATATGGCCAGCGCAGG + Intergenic
1050122532 9:2321971-2321993 ACATTTTTTATTGTCACAACTGG - Intergenic
1050705091 9:8387454-8387476 ACATTTTATCTTGACACTGCAGG - Intronic
1050801658 9:9622998-9623020 ACATTTTCTATTACCACACAAGG - Intronic
1054870066 9:70040940-70040962 ACATTGTGTATTGCCACCTATGG - Intergenic
1055862928 9:80775239-80775261 ACATCTTCTATTCCCAGCCCAGG - Intergenic
1055938464 9:81625656-81625678 ACATTTTCTTTTGACGCCACTGG - Intronic
1056144358 9:83714893-83714915 ACATTTTCTATTGTCATGACAGG - Intergenic
1060463348 9:123879638-123879660 ACATTTCCAATTTCCACAGCTGG + Intronic
1185862997 X:3596469-3596491 ACATTTTTAATTGTCACCACAGG + Intergenic
1186444795 X:9618008-9618030 ACATTTTCAGTTGCCACAACTGG - Intronic
1186648588 X:11534528-11534550 ACATTTTTGGTTGCCACTGCTGG - Intronic
1186801029 X:13092562-13092584 ACATTTTAGGTTGCCACAGCTGG + Intergenic
1188103057 X:26114495-26114517 ATATCTGCTATTGCCACCCCTGG + Intergenic
1192695638 X:73412627-73412649 ACATTTTTAGTTGCCACAGCTGG - Intergenic
1193707119 X:84834812-84834834 AATTTTTCTATTGCCACTTCTGG + Intergenic
1195802276 X:108726348-108726370 ACAATTCCTATTGCCATGGCTGG - Intronic
1197313234 X:124931717-124931739 ACATTTTCTGTGGCCTACGCTGG + Intronic
1197478871 X:126958128-126958150 GCATTTTATATTGCCACAGCGGG + Intergenic