ID: 1140734797

View in Genome Browser
Species Human (GRCh38)
Location 16:77888726-77888748
Sequence AGACATTGTCAAATGTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2912
Summary {0: 11, 1: 139, 2: 434, 3: 873, 4: 1455}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140734787_1140734797 21 Left 1140734787 16:77888682-77888704 CCTCTACTCCCGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1140734797 16:77888726-77888748 AGACATTGTCAAATGTCTCCTGG 0: 11
1: 139
2: 434
3: 873
4: 1455
1140734790_1140734797 13 Left 1140734790 16:77888690-77888712 CCCGTACCGCCAGCGGTGGCAAT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1140734797 16:77888726-77888748 AGACATTGTCAAATGTCTCCTGG 0: 11
1: 139
2: 434
3: 873
4: 1455
1140734791_1140734797 12 Left 1140734791 16:77888691-77888713 CCGTACCGCCAGCGGTGGCAATA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1140734797 16:77888726-77888748 AGACATTGTCAAATGTCTCCTGG 0: 11
1: 139
2: 434
3: 873
4: 1455
1140734793_1140734797 4 Left 1140734793 16:77888699-77888721 CCAGCGGTGGCAATAGAAAATGT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1140734797 16:77888726-77888748 AGACATTGTCAAATGTCTCCTGG 0: 11
1: 139
2: 434
3: 873
4: 1455
1140734792_1140734797 7 Left 1140734792 16:77888696-77888718 CCGCCAGCGGTGGCAATAGAAAA 0: 1
1: 0
2: 1
3: 79
4: 248
Right 1140734797 16:77888726-77888748 AGACATTGTCAAATGTCTCCTGG 0: 11
1: 139
2: 434
3: 873
4: 1455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140734797 Original CRISPR AGACATTGTCAAATGTCTCC TGG Intronic
Too many off-targets to display for this crispr