ID: 1140734798

View in Genome Browser
Species Human (GRCh38)
Location 16:77888727-77888749
Sequence GACATTGTCAAATGTCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2494
Summary {0: 7, 1: 132, 2: 358, 3: 796, 4: 1201}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140734792_1140734798 8 Left 1140734792 16:77888696-77888718 CCGCCAGCGGTGGCAATAGAAAA 0: 1
1: 0
2: 1
3: 79
4: 248
Right 1140734798 16:77888727-77888749 GACATTGTCAAATGTCTCCTGGG 0: 7
1: 132
2: 358
3: 796
4: 1201
1140734791_1140734798 13 Left 1140734791 16:77888691-77888713 CCGTACCGCCAGCGGTGGCAATA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1140734798 16:77888727-77888749 GACATTGTCAAATGTCTCCTGGG 0: 7
1: 132
2: 358
3: 796
4: 1201
1140734790_1140734798 14 Left 1140734790 16:77888690-77888712 CCCGTACCGCCAGCGGTGGCAAT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1140734798 16:77888727-77888749 GACATTGTCAAATGTCTCCTGGG 0: 7
1: 132
2: 358
3: 796
4: 1201
1140734793_1140734798 5 Left 1140734793 16:77888699-77888721 CCAGCGGTGGCAATAGAAAATGT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1140734798 16:77888727-77888749 GACATTGTCAAATGTCTCCTGGG 0: 7
1: 132
2: 358
3: 796
4: 1201
1140734787_1140734798 22 Left 1140734787 16:77888682-77888704 CCTCTACTCCCGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1140734798 16:77888727-77888749 GACATTGTCAAATGTCTCCTGGG 0: 7
1: 132
2: 358
3: 796
4: 1201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140734798 Original CRISPR GACATTGTCAAATGTCTCCT GGG Intronic
Too many off-targets to display for this crispr