ID: 1140734799

View in Genome Browser
Species Human (GRCh38)
Location 16:77888730-77888752
Sequence ATTGTCAAATGTCTCCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1335
Summary {0: 1, 1: 36, 2: 163, 3: 376, 4: 759}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140734793_1140734799 8 Left 1140734793 16:77888699-77888721 CCAGCGGTGGCAATAGAAAATGT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1140734799 16:77888730-77888752 ATTGTCAAATGTCTCCTGGGTGG 0: 1
1: 36
2: 163
3: 376
4: 759
1140734790_1140734799 17 Left 1140734790 16:77888690-77888712 CCCGTACCGCCAGCGGTGGCAAT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1140734799 16:77888730-77888752 ATTGTCAAATGTCTCCTGGGTGG 0: 1
1: 36
2: 163
3: 376
4: 759
1140734787_1140734799 25 Left 1140734787 16:77888682-77888704 CCTCTACTCCCGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1140734799 16:77888730-77888752 ATTGTCAAATGTCTCCTGGGTGG 0: 1
1: 36
2: 163
3: 376
4: 759
1140734792_1140734799 11 Left 1140734792 16:77888696-77888718 CCGCCAGCGGTGGCAATAGAAAA 0: 1
1: 0
2: 1
3: 79
4: 248
Right 1140734799 16:77888730-77888752 ATTGTCAAATGTCTCCTGGGTGG 0: 1
1: 36
2: 163
3: 376
4: 759
1140734791_1140734799 16 Left 1140734791 16:77888691-77888713 CCGTACCGCCAGCGGTGGCAATA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1140734799 16:77888730-77888752 ATTGTCAAATGTCTCCTGGGTGG 0: 1
1: 36
2: 163
3: 376
4: 759

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140734799 Original CRISPR ATTGTCAAATGTCTCCTGGG TGG Intronic
900691407 1:3982661-3982683 ATTGCCAAATGTCTCCTGGGAGG - Intergenic
900774262 1:4570312-4570334 ATTGCCAAGTTTCTCCGGGGTGG - Intergenic
900794839 1:4701679-4701701 ATTGCCAAATGTCCCCTGAGGGG + Intronic
900884891 1:5408122-5408144 ATGGCCAAATGTCCCCTCGGGGG + Intergenic
901102214 1:6727665-6727687 ATTGCCAAATGTCCCCTGCAAGG - Intergenic
901346055 1:8543753-8543775 CTTGCCAAATGTCTCCTGTGAGG + Intronic
901407436 1:9058563-9058585 ATTGTTAAGTGTCCCCTGGTGGG + Intronic
901607180 1:10468330-10468352 ATTGTCAGATGTCTCCTGGGGGG - Intronic
901741897 1:11347270-11347292 ATTGTCAAATGTCTGGGGGGTGG - Intergenic
902145182 1:14392719-14392741 ATTGCCAAATGTCCCCTGGGCGG + Intergenic
902158797 1:14512441-14512463 GTTGACGAATGTCCCCTGGGTGG + Intergenic
902196506 1:14802438-14802460 ATTGCCCAGTGTCCCCTGGGTGG - Intronic
902288623 1:15422523-15422545 ATTGCCAGATGTCTCCTGGGGGG + Intronic
902294307 1:15455967-15455989 GTTGTCAAACGTCTCCTGGTGGG + Intergenic
902374241 1:16022837-16022859 ACTGCCCAAAGTCTCCTGGGTGG + Intronic
902379192 1:16044714-16044736 ACTGCCCAAAGTCTCCTGGGTGG + Intronic
902391660 1:16110780-16110802 AGAGCCAAATGTCCCCTGGGTGG + Intergenic
902532069 1:17097006-17097028 ATTGTCAAATGTCCCTTGGGAGG + Intronic
902888205 1:19422177-19422199 ATTGCCAGATGTCTCCTGGCAGG - Intronic
902951628 1:19888074-19888096 ATTGCCAAATGTCCCCTGGAGGG - Intronic
903248465 1:22034441-22034463 ATTGTCAAATGTCCTGGGGGTGG + Intergenic
903262382 1:22138407-22138429 TTTGCCAAATGTCCCCTGGGGGG - Intronic
903303749 1:22397714-22397736 ATTGCCAACTGTCCCCTGGGGGG + Intergenic
903344504 1:22675839-22675861 ATTGTCAAATGTCCCCTGGGGGG - Intergenic
903517931 1:23924963-23924985 ATCATCAGATGTCACCTGGGAGG - Intergenic
903708719 1:25306131-25306153 ATTGTAAGATGTCCCCTGGGGGG - Intronic
903718391 1:25386287-25386309 ATTGTCAGATGTCCCCTGGGGGG + Intronic
904933006 1:34105354-34105376 ATTGCCAAATGTCCCCTAGGGGG + Intronic
905178671 1:36153711-36153733 ATGGCTAAATGTCTCCTGGGGGG + Intronic
905315308 1:37079083-37079105 ACTGCCAAGTGTCCCCTGGGGGG + Intergenic
905627881 1:39500322-39500344 ATTGCCAAATGTTTCCTGGGAGG - Intronic
905681396 1:39874367-39874389 ATTGCCAAACGTCCCCTAGGAGG + Intronic
905775788 1:40666282-40666304 ATGGTCGAATGTTCCCTGGGGGG - Intergenic
905798412 1:40828435-40828457 ATTGCCACATGTCCCCTGAGTGG + Intronic
906005486 1:42465706-42465728 ATTGCCAAATGTCTCACAGGGGG - Intronic
906182194 1:43831517-43831539 ATTGTCAAATGTATCATTGCTGG + Intronic
906258987 1:44372042-44372064 ATTGCCAAGTGTCCCCTGGAAGG - Intergenic
906370789 1:45251837-45251859 ATTGCCAAATGTGCCCTGGAAGG - Intronic
907229444 1:52982249-52982271 ATTGTCAAATGTCTTCTGGGGGG + Intronic
907502846 1:54895340-54895362 ATTGCCACATGTCCCCTAGGAGG + Intergenic
907841551 1:58162898-58162920 ATTGCCAAATGTTCCCTGGAGGG - Intronic
907984770 1:59519928-59519950 ATTGCCAAATGTCCCCTGAGGGG - Intronic
908064949 1:60392647-60392669 ATTGTCAAATGTCCCCTCGATGG + Intergenic
908288516 1:62637416-62637438 ATTGCCAAATGTTCCCTTGGGGG - Intronic
908478555 1:64513301-64513323 AATGTCAAGTGTCCCCTGGGGGG + Intronic
908868901 1:68584933-68584955 ATTTCCAAATGTCTCCTTGAAGG - Intergenic
909140744 1:71861901-71861923 TTTTTTAAATGTCTCCTGGCAGG - Intronic
909425856 1:75523743-75523765 ATTGTCAAATGTCCCCTGTGGGG - Intronic
909430926 1:75587025-75587047 ATAGCCAAATGTCTTCTAGGGGG - Intronic
909777744 1:79504348-79504370 ATTTTCAAATGTATTTTGGGGGG + Intergenic
909849441 1:80441844-80441866 ATTGCCAAATGTTTCCTGGAGGG + Intergenic
910164353 1:84308463-84308485 ATTGCCAAATGTTCCCTGAGGGG + Intronic
910241353 1:85089708-85089730 ATTGCCAAATGTCCCATGAGGGG + Intronic
910447916 1:87317600-87317622 ATTGCCAAATGTCCACTGGGGGG + Intergenic
910878147 1:91897218-91897240 ACTGTCAAATGTAGCCTGCGGGG + Intronic
910949023 1:92624862-92624884 ATTGCCAAATGTCCCCTGGCGGG - Intronic
910973388 1:92880025-92880047 ATTGCCAAGTGTCCCCTGTGGGG - Intronic
911167464 1:94736861-94736883 ATTATCAAATGTCCCCTGGAAGG + Intergenic
911358241 1:96846965-96846987 ATTGTCAAATGTCCCCTTGGTGG + Intergenic
911694189 1:100869921-100869943 ATTGCCAGATGTCCCCTCGGGGG + Intergenic
911858635 1:102915233-102915255 ATTGTCAAATATTTCCTGGTGGG + Intronic
911956854 1:104247061-104247083 ATTGTCAAATGTCCTCTGGGGGG + Intergenic
912198051 1:107423281-107423303 ATTGCCAAATGTCCCCTGGGGGG - Intronic
913015506 1:114729931-114729953 ATTGCCAAATGTCCCCTGGGAGG - Intronic
913373122 1:118122626-118122648 ATTGCCAAATGTTCCCTTGGGGG + Intronic
913416540 1:118615101-118615123 ATTGGCACAGATCTCCTGGGGGG + Intergenic
913715214 1:121526860-121526882 ATTGCCAAATGTCTCCTGTGGGG + Intergenic
914814289 1:151052146-151052168 ATTGCCAGATTTCTCCTAGGGGG - Exonic
914868017 1:151449317-151449339 ATTGCCAAATGCCCTCTGGGGGG - Intronic
915168389 1:153961466-153961488 ATTACCAAATGTTTCCTGAGGGG + Intronic
915495430 1:156279235-156279257 ATTGCCAAATGTCCCCTGGTGGG - Intronic
916142779 1:161713705-161713727 ATTGCCCAATGTCCTCTGGGGGG - Exonic
916266780 1:162898116-162898138 ATTGTCAGAGGTCCCTTGGGGGG - Intergenic
916428536 1:164705206-164705228 ATTGCCAGATGTCTCCTGGGAGG + Intronic
916466091 1:165075883-165075905 ATTGTCACATGTTCCCTGGAAGG - Intergenic
916526810 1:165618107-165618129 ATTGCCAAATGTCCCCTGTGAGG + Intergenic
916854388 1:168735191-168735213 ATTGCTAAATGTCTCCTGGAGGG + Intergenic
917037729 1:170767735-170767757 ATTGCCAAATGTTTCCTGGGGGG - Intergenic
917265205 1:173213866-173213888 ATTTTCAAATGACCCCTAGGGGG - Intergenic
917758153 1:178124272-178124294 TTTGTCAAATGTCCCCTGGAGGG - Intronic
918314343 1:183310571-183310593 ATTGCCAAATGTGCCCTGGGGGG - Intronic
918499656 1:185179845-185179867 ATTGCCAAATGTCCCCTGAGGGG - Intronic
918553634 1:185773149-185773171 AATGCCAAATGTCCCCTGGAGGG - Intronic
918656572 1:187033965-187033987 AATGTCAAATGTCATCTGGCCGG - Intergenic
918766373 1:188489638-188489660 ATTGTCAAAAGCCTCCAGGGAGG - Intergenic
919807745 1:201390774-201390796 ATTGCCAAATGTCTCCTGGGGGG + Intronic
920008064 1:202847806-202847828 ATTGCCAAATGTCCGCTGGAGGG + Intergenic
920023986 1:202978501-202978523 ATTGCCAAATGTCCCCAGGGGGG + Intergenic
920532070 1:206709917-206709939 ATTGCCAAACGTCCCCTGGGGGG + Intronic
920846990 1:209602302-209602324 ATTGCCAAATGTTCCCTGAGAGG + Intronic
920881644 1:209886384-209886406 ATTGCCAAATGTCCCCTGAGAGG + Intergenic
921167399 1:212516923-212516945 ATTGCCAAATGTCCCCTGGGTGG - Intergenic
921169639 1:212535105-212535127 ATTTTCAATTGTCTACTGGATGG + Intergenic
921720437 1:218464940-218464962 ATTGTCAAATATCCCCTGAGGGG - Intergenic
921734246 1:218608793-218608815 ATTGCCAAATATCTCCTAGCAGG - Intergenic
921822892 1:219637763-219637785 ATTGCCAAATGTTTCCTAGAAGG + Intergenic
921911535 1:220554352-220554374 ATTGGCACATGTGCCCTGGGAGG - Intronic
922386053 1:225084299-225084321 ATTGTCAAATTTCTACAGGATGG - Intronic
922647556 1:227304643-227304665 ATTACCAAATGTCTCCTATGGGG + Intronic
923054801 1:230417963-230417985 ATTGCCAAATGTCCCCTGGGGGG - Intronic
923629378 1:235639918-235639940 GCTGTCAAATGTCTCCTGGACGG + Intronic
924056904 1:240132950-240132972 ATTGTCAAATGTCCTCTGCAGGG - Intronic
924095004 1:240542028-240542050 ATTGACAAATGTCCCCTGAGGGG - Intronic
924235455 1:241996226-241996248 GCAGCCAAATGTCTCCTGGGAGG + Exonic
924320446 1:242843351-242843373 ATTTCCAAATGTCTTCTGAGTGG + Intergenic
924368427 1:243321148-243321170 ATTGCCAAATGTCCTCTGGTGGG + Intronic
1063155889 10:3378970-3378992 AACTGCAAATGTCTCCTGGGGGG - Intergenic
1063226367 10:4018676-4018698 ATTTCCAAATACCTCCTGGGGGG - Intergenic
1063521666 10:6747109-6747131 ATTGCCAAATGTCCTCCGGGGGG + Intergenic
1063525676 10:6782613-6782635 ATTGCCAAATGTCTCCTGGGAGG + Intergenic
1063587639 10:7366924-7366946 ATTGCCAGGTGTCCCCTGGGGGG + Intronic
1063630057 10:7724844-7724866 ATTGCCAAATGTCCGCTGGGGGG + Intronic
1063686467 10:8241561-8241583 ATTACCAAATGTCCCCTGAGAGG + Intergenic
1063705856 10:8430211-8430233 ATTGCCAAGTGTCCCCTGGTGGG + Intergenic
1064731417 10:18334726-18334748 ATTGCCCAATGTCCCCTGAGGGG + Intronic
1064863642 10:19854404-19854426 ATTGCCATATGGCCCCTGGGAGG - Intronic
1065042609 10:21712786-21712808 ATTGTGAAATGTCCCTTGTGGGG + Intronic
1065065154 10:21955114-21955136 ATTGTCAAATGTCCCTGGGCAGG + Intronic
1065391302 10:25185092-25185114 ATTGCCAAATATCCCCTGTGGGG + Intronic
1065412432 10:25444100-25444122 ATTGCCAGATATCCCCTGGGGGG + Intronic
1065484822 10:26227587-26227609 ATTGCCAAATGTCCCTTGTGGGG - Intronic
1066084949 10:31967264-31967286 ATTGCCAAATATCCCCTGGGTGG - Intergenic
1066541376 10:36450293-36450315 ACTGTCAAATGTCTATTGAGAGG - Intergenic
1066587213 10:36949118-36949140 ATTGCCAAATGTGCCCTGGGGGG - Intergenic
1068066919 10:52143448-52143470 ATTGCCAAATGTCTCCTGTGGGG + Intronic
1068113980 10:52715977-52715999 ATTTCCAAATATCTCCTGAGGGG + Intergenic
1068382857 10:56280935-56280957 ATTATGATATGTCTCCTGGCTGG - Intergenic
1068693540 10:59942129-59942151 ATTGCCAAATGTCACCAGGGAGG - Intergenic
1068768486 10:60793014-60793036 ATTGCCAAATGTCTCCTGATGGG + Intronic
1068831597 10:61501872-61501894 ATTGTCAAAAATCCCCTGGGTGG + Intergenic
1069762459 10:70821543-70821565 ATTGTCAAATGTCACCCAGAGGG - Intronic
1069882990 10:71605347-71605369 ATTGCCAAATGTCTCCTGAGAGG - Intronic
1070066774 10:73042749-73042771 ATTGTCAAATGTCCCCTGATAGG - Intronic
1070455010 10:76604436-76604458 ATCGCCAAATGTCATCTGGGGGG + Intergenic
1070550935 10:77490097-77490119 ATTTGCCAATGTCTCATGGGAGG + Intronic
1070666618 10:78349560-78349582 ATTGCCAAATGTCCCCTGGTGGG - Intergenic
1071038482 10:81277344-81277366 ATGGCCAAATGTCTCTGGGGCGG + Intergenic
1071115875 10:82219336-82219358 ATTGTCAGATGTCTTCTGGGGGG + Intronic
1071384966 10:85110685-85110707 ATGGGCTCATGTCTCCTGGGGGG - Intergenic
1072302728 10:94077197-94077219 ATTGCCAAGTGTCACCTCGGGGG - Intronic
1072642946 10:97226948-97226970 ATTGCCAAATGTCCCATGGTGGG - Intronic
1072894122 10:99350982-99351004 ATGGCCAAATGTCCCCTGGGGGG + Intronic
1073239593 10:102047846-102047868 ATTGACAAATGTCCCCTGGGAGG - Intronic
1073302233 10:102477904-102477926 ATTGCCAGATGTGTCCTGGGAGG + Intergenic
1073504934 10:103977022-103977044 ATTGCCAAATGTCTCCTGGATGG + Intronic
1074404521 10:113169488-113169510 ATCGCCAGATGTCCCCTGGGGGG + Intergenic
1074580780 10:114717554-114717576 ATTGTCAAATGTCCCCTGAGGGG + Intergenic
1074694640 10:116038528-116038550 ATTGCCAAATGTCCCCTGGAAGG + Intergenic
1074824458 10:117204492-117204514 ATTGCCAAATTTCCTCTGGGGGG + Intronic
1074898753 10:117798798-117798820 AATCACAAATGTCTCCTGGGAGG + Intergenic
1074935259 10:118172241-118172263 ATTGCCAAATGTCCCCTAGAAGG - Intergenic
1075060198 10:119251827-119251849 TTTGTCAAATGTCCTCTTGGGGG + Intronic
1075071445 10:119322403-119322425 ATTGCCAAATGTTCCCTGGGAGG + Intronic
1075124465 10:119688581-119688603 ATTGCCAAATGTCCCCTGGTGGG + Intergenic
1075149709 10:119916220-119916242 ATTGCCAGATGTCCCCTGGAGGG + Intronic
1075215494 10:120529130-120529152 ATTGCTAAATGTCCCCTGGGGGG - Intronic
1075270458 10:121044927-121044949 ATTGCTAAGTGTCCCCTGGGGGG - Intergenic
1075301007 10:121324349-121324371 GTTTCCAAATATCTCCTGGGGGG - Intergenic
1075306204 10:121369958-121369980 ATTGCCAAATGACTCCTGGGGGG - Intergenic
1075475667 10:122731258-122731280 ATTGCCAAATATCCCCTGGAGGG - Intergenic
1075754037 10:124796648-124796670 AGTGCCAAATGGCTCCTGGAAGG - Intergenic
1075833045 10:125427669-125427691 ATTGACAAATGTCCCTTGGGAGG - Intergenic
1075931543 10:126301016-126301038 ATTGCCACATGTTCCCTGGGGGG - Intronic
1076422958 10:130345116-130345138 ATTGTCAAAACTCTACTGTGTGG + Intergenic
1076618736 10:131773458-131773480 ACTGCCAGATGTCCCCTGGGGGG - Intergenic
1077458345 11:2694331-2694353 ATTGCCATATGTCCCCTGGGGGG - Intronic
1078265540 11:9753752-9753774 GTTGCCAAATGTCCCCTGGAGGG - Intergenic
1079021202 11:16910611-16910633 ATTATCAAATGTCCCCTGGGGGG - Intronic
1079047942 11:17125251-17125273 ATTACCAAATGTCTGCTGGAAGG - Intronic
1079127699 11:17730656-17730678 ACTGCCAAATGTACCCTGGGAGG - Intergenic
1079226767 11:18613579-18613601 ATTGCCAAAAGTCCCCTGGAGGG + Intronic
1080101566 11:28465880-28465902 ATTGCCAAATGTCTTCTAAGAGG + Intergenic
1080160013 11:29162482-29162504 ATTATCAAATGCCCCCTGGAGGG - Intergenic
1080955664 11:37092057-37092079 ATTGTTAGATGTCTCCTGGGGGG + Intergenic
1081193306 11:40130647-40130669 ACTGCCAAATGTCCCCTGGGGGG + Intronic
1082808905 11:57466795-57466817 ATTGCCAAATGTCCCCTGGGGGG - Intronic
1082913876 11:58409719-58409741 ATTGTCATATGTGTCCTCTGAGG - Intergenic
1083074000 11:60018300-60018322 ATTGCCAAATGTCCCCTGGAGGG - Intergenic
1083486616 11:62986987-62987009 ATTGCCAAGTGTCCCCTGGGGGG - Intergenic
1084336924 11:68463825-68463847 ACTGCCAAATGTTTCCTGGGGGG - Intronic
1084789688 11:71465651-71465673 ATTACCAGATGTCCCCTGGGGGG + Intronic
1084795114 11:71500384-71500406 ATCGCCTAATGTCTCCTCGGGGG - Intronic
1085557416 11:77437539-77437561 ATTGCCAAATGTCACCTGGAAGG - Intronic
1085786150 11:79452036-79452058 ATTGCCAAATGTCCCCTCTGGGG + Intergenic
1085829558 11:79884981-79885003 ATTGCCAAATGTCCCCAGGGGGG - Intergenic
1085900881 11:80698853-80698875 ATTGCCAAATGTGCCCTGGGGGG + Intergenic
1086260623 11:84935591-84935613 ATTGCCAAATGTCTTCTAGAGGG - Intronic
1086382898 11:86276165-86276187 ATTGTCAAATGTCCCTTCGTGGG + Intronic
1086466695 11:87061260-87061282 ATTGTTAAATGTCTCCTAGGAGG - Intronic
1087130127 11:94661942-94661964 AGTATCCAATGTCTCCTAGGTGG - Intergenic
1087140634 11:94762351-94762373 ATTGCCAAATGTCCCCTAGGGGG - Intronic
1087209776 11:95435467-95435489 ATTGTTAAGAGTTTCCTGGGAGG + Intergenic
1087283679 11:96241424-96241446 ATTGCCAAATGTCTCCTGGGGGG - Intronic
1087290468 11:96315151-96315173 ATTGTCAAGTATCCCCTGGAAGG - Intronic
1087698476 11:101408590-101408612 AATGTCAAATGTCCCCTGTGGGG - Intergenic
1087779888 11:102290828-102290850 ATTGCCAAATGTCCCCCGGGGGG - Intergenic
1088148486 11:106714695-106714717 ATTGCCAAATGTCCACTGAGGGG - Intronic
1088313443 11:108484180-108484202 ATTGGCAAATGTCCTCTGAGGGG + Intronic
1088328447 11:108626046-108626068 ATTGTCAGATGCCTAGTGGGAGG - Intergenic
1088390660 11:109311024-109311046 ATTGTCAGTTGTCCTCTGGGGGG + Intergenic
1088416295 11:109592699-109592721 ATTGCTAAATGTCCTCTGGGGGG - Intergenic
1088941991 11:114468558-114468580 ACTTCCAAATGTCCCCTGGGGGG - Intergenic
1089310962 11:117557855-117557877 ATTGCCATATGTCTCCTAAGGGG - Intronic
1089555480 11:119313841-119313863 ATTGCCAAGTATCTCCTAGGAGG + Intronic
1090181758 11:124705692-124705714 ATCGCCAAGTTTCTCCTGGGGGG - Intergenic
1090305735 11:125689465-125689487 ATTGCCAAATGTGCCCTGGAGGG - Intergenic
1090441803 11:126730536-126730558 GTTGCCAAATGTCCCCTAGGTGG - Intronic
1090829634 11:130411947-130411969 ATTGCCAAATGTCCCCTGGAGGG - Intronic
1090920973 11:131205528-131205550 AAAGTCAAATGTCCCCTGTGGGG + Intergenic
1091031035 11:132188040-132188062 ATTGCCAAATGTTCCCTGGAGGG - Intronic
1091728546 12:2863091-2863113 ATTGCCAAATGTCCCCTGGCAGG - Intronic
1091953781 12:4618708-4618730 ATTGCCAAATGTCCCCTGGGGGG + Intronic
1092172090 12:6380183-6380205 ATTGCCAAATGACTTCTGGGGGG + Intronic
1092307958 12:7321055-7321077 ACTGCCGAATGTCTTCTGGGGGG + Intronic
1092673827 12:10893519-10893541 ATTATTAAATGTCCCCTAGGGGG + Intronic
1092861224 12:12720775-12720797 ATTGCCAAATGTTCCCTGTGGGG + Intronic
1093295440 12:17384100-17384122 ATTGGCATAGGTCTCCTGGGGGG + Intergenic
1093311253 12:17588823-17588845 AATGTCAAATTTCTGCTGGTAGG - Intergenic
1093398590 12:18714698-18714720 ATTGCCAAATCCCTCCTGTGAGG - Intronic
1093699187 12:22198930-22198952 ATTGCCAAATGTCACCAGAGAGG + Exonic
1093750921 12:22799209-22799231 ATTGCCAAGTGTCCCCTGTGTGG + Intergenic
1093760085 12:22899760-22899782 ATTGCTGAATGTCCCCTGGGAGG - Intergenic
1093856567 12:24111146-24111168 ATTGCCAAATGTCCCACGGGAGG + Intergenic
1093957822 12:25241818-25241840 GTTGCCAAATGTCCCCTGGAGGG + Intronic
1095980110 12:47967883-47967905 ATTGCCAGAAGTCTCCTGTGGGG + Intronic
1096196532 12:49652198-49652220 GTTCTCATATGTCTCCTGGCAGG + Exonic
1098096334 12:66960664-66960686 ATTGTCAGATATCCCCTGAGGGG - Intergenic
1098154026 12:67578608-67578630 ATTGCTAAATGTCTCTTGGGGGG - Intergenic
1098494075 12:71114646-71114668 ATTGACAAATATCCCCTGAGAGG + Intronic
1098910218 12:76201467-76201489 ATTGCCACATGTCCCCTGGGGGG + Intergenic
1099023159 12:77431965-77431987 ATTGCCAAATGTCACCTGAAGGG - Intergenic
1099297725 12:80850535-80850557 ATTGCCAAATGTCTCCTGAAGGG - Intronic
1100362852 12:93894202-93894224 ATTGTCAAATGTCCCCTGGAAGG - Intronic
1100483047 12:94997907-94997929 ATTGCCAAATGTCCCCTTGGGGG - Intronic
1100527565 12:95433802-95433824 ATTGCCAAATGTCCCTTGTGGGG + Intergenic
1100569052 12:95829157-95829179 ATTGCCAAATGTCCCCTGGGAGG - Intergenic
1100611937 12:96197242-96197264 ATTGCCAAATGTCTCCTGGGAGG - Intronic
1100664907 12:96740795-96740817 ATTGCCAAATTTCCCCCGGGAGG - Intronic
1100764058 12:97843954-97843976 CCTGTTAAATGTCTCCTGGCTGG + Intergenic
1100777778 12:97991252-97991274 ATTTTCAAATATCTGCTGGTAGG - Intergenic
1100845990 12:98658675-98658697 ATTGTCAAATGTCACCTGGGGGG - Intronic
1100971653 12:100077609-100077631 ATTGCCAAATGTCCCCTGGGGGG + Intronic
1100977554 12:100138065-100138087 ATTGCCAAATGTCTCATAGGAGG - Intronic
1101047038 12:100818751-100818773 ATTGTCAAATGTTCTCTGGGAGG - Intronic
1101099242 12:101375348-101375370 ATTGCCAAATGTCACCTGGGGGG - Intronic
1101317859 12:103645862-103645884 ATTGCCAAATGGCTTCTGGGCGG + Intronic
1101343281 12:103861941-103861963 ATTGCCAAAAGTCCCCTAGGTGG + Intergenic
1101356090 12:103978756-103978778 AATGTCAAATGTCCCTTGGGAGG - Intronic
1101365519 12:104066035-104066057 ATTACCAAATGTCTTCTGGGGGG + Intronic
1101631781 12:106502107-106502129 GTTGTTAAATGTCCCCTGGGAGG - Intronic
1101744771 12:107531249-107531271 ACTGCCAAATGTTCCCTGGGAGG + Intronic
1101867518 12:108531846-108531868 ATTGCCAAATGTCTCTTGATGGG - Intronic
1101895137 12:108750834-108750856 ACTGCCAAATGTCCCCTGGGGGG - Intergenic
1101945698 12:109134749-109134771 ATTGACAAATGTCCCATGGGAGG - Intronic
1102039092 12:109789177-109789199 ATTGTCAAATGTCCCCTGGTGGG - Intronic
1102137313 12:110586141-110586163 ATTGCCAAATGTCCCCTGGGGGG + Intergenic
1102214319 12:111149552-111149574 GTTACCAAATGTCCCCTGGGAGG + Intronic
1102279442 12:111607428-111607450 ATTGCCAAATGTCTCCTGAGGGG - Intergenic
1102411046 12:112719028-112719050 ATTGCCAAATGACCTCTGGGAGG - Intronic
1102480206 12:113217946-113217968 ATTGCCAAATGTCTTCTGGAGGG - Intronic
1102581205 12:113889252-113889274 ATTTCCAAATGTCCCCTGGCAGG + Intronic
1102624286 12:114222186-114222208 ATGGTCAAATATCCCCTAGGGGG - Intergenic
1102769526 12:115463017-115463039 ATTGCCAAATGTCCCCTGGGAGG - Intergenic
1102791748 12:115652198-115652220 ATTGCCAAATGTCCCTTGCGGGG - Intergenic
1102841623 12:116131111-116131133 ATTGCCAAATGTCCTCTGGGGGG + Intronic
1102910913 12:116713180-116713202 ATTGCCAAATGTTCCCTGGGGGG + Exonic
1103013949 12:117479585-117479607 ATCATCAAATGTCCCCTGGAGGG + Intronic
1103068137 12:117917133-117917155 GTTGCCAAATGTCCCCTGGGAGG + Intronic
1103272410 12:119684396-119684418 ATTGTCAAATGTCCTCTGGGAGG + Intergenic
1103336067 12:120190641-120190663 ATTGTCAAATGTCTCCTGGCAGG + Intronic
1103766923 12:123287014-123287036 GTTGGCAAATGTCTCCTGGGGGG - Intergenic
1103790747 12:123469104-123469126 ACTGCCAAATGTCCCCTGGGGGG + Intronic
1103809953 12:123605359-123605381 ATTGTCAAATGTTCCCTCAGGGG + Intronic
1103991754 12:124804107-124804129 ATGCTCAGATGGCTCCTGGGTGG - Intronic
1104269723 12:127272305-127272327 ATTGTCAAATGCCCCCTGGGGGG - Intergenic
1104369444 12:128210561-128210583 ATTGTCAAATATGACCTGAGGGG + Intergenic
1104488048 12:129168794-129168816 ATTGCCAAATGTCCCCTGGGTGG + Intronic
1104647015 12:130504889-130504911 ATTGCCAAATATCCCCTGGAGGG + Intronic
1105044945 12:132994963-132994985 ATTGTCAAATGCCCCCGGGGGGG + Intronic
1105810969 13:23994959-23994981 ACTGCCAGATGTCCCCTGGGAGG - Intronic
1106010935 13:25821843-25821865 CCTGTCAAATGTCTCCTCAGAGG + Intronic
1106014147 13:25852202-25852224 ATTGCCAAATGTCCCCTGGGAGG - Intronic
1106443239 13:29799259-29799281 ATTGCCAAATGTCTCCTAGGGGG + Intronic
1106510167 13:30406340-30406362 ATTGCCAAATGTCTCCTGGGCGG + Intergenic
1106592084 13:31106619-31106641 GTTTTAAAAAGTCTCCTGGGAGG + Intergenic
1107053785 13:36080854-36080876 ATTGCCAAATGTCCTCTGGGAGG - Intronic
1107066250 13:36216707-36216729 ATTGCCAAATGTCCCTTGGAGGG - Intronic
1107131856 13:36905054-36905076 ATTGCCAGATGTCCCGTGGGGGG - Intronic
1107559825 13:41549056-41549078 ATTGCCAAATGGCCCCTGGGAGG - Intergenic
1107595187 13:41956271-41956293 ATTGCTAAATGTCCCCTGAGGGG + Intronic
1107650551 13:42540766-42540788 ATTGCCAAATGTCCCCCGGGAGG + Intergenic
1107715972 13:43199763-43199785 ATTTCCAAAAGTCCCCTGGGGGG - Intergenic
1107888970 13:44897442-44897464 ATTGCCAAGTGTTTCCTCGGAGG - Intergenic
1108669959 13:52675915-52675937 ATGGCTAAATGTCCCCTGGGTGG + Intronic
1109077614 13:57857907-57857929 ATTGTCAAATATTCCCTGGAGGG - Intergenic
1109231699 13:59765301-59765323 ATTGGCAAATGTATCATGGAAGG + Intronic
1109331009 13:60929729-60929751 ATTGCCAAACATCTCCTGGAAGG + Intergenic
1110061065 13:71038766-71038788 GTTGTCAAATCTTTCTTGGGGGG + Intergenic
1110241392 13:73271090-73271112 ATTGCCACATGTCTCCTGGGGGG + Intergenic
1110547358 13:76770374-76770396 ATTGCCAAATGATTCCTGGAGGG - Intergenic
1111713683 13:91850313-91850335 ATTAGCAAATGTCACCTGAGGGG - Intronic
1112002390 13:95222806-95222828 GTTGCCACATCTCTCCTGGGAGG - Intronic
1112695089 13:101938909-101938931 ATTATCAAATGTTCCCTGGAGGG - Intronic
1112912208 13:104500785-104500807 ATTGTCAAATGTCCCTTAGGGGG - Intergenic
1113127420 13:106995315-106995337 GTTGCCAAATGTCTCCTGTTGGG - Intergenic
1113140496 13:107143458-107143480 TTTGCCAAATATCTCCTGGAAGG - Intergenic
1114350785 14:21848716-21848738 TTTGTCAAATGTCTCCTGAGGGG + Intergenic
1114810696 14:25895422-25895444 ATTGTCAAGTGACTTCTGGTAGG - Intergenic
1114821380 14:26023624-26023646 ATTGCCAAATGTCCTCTGGGAGG + Intergenic
1114874570 14:26699864-26699886 ACTGTCAAATGTCCCATGGAGGG - Intergenic
1115558787 14:34564422-34564444 ATTGCAAAATGTCCTCTGGGGGG + Intronic
1115848697 14:37569088-37569110 ACTGTCATATGTATCCAGGGTGG + Intergenic
1116182112 14:41547898-41547920 ATTCTCAGAAGTCTCCTGGGGGG + Intergenic
1117141227 14:52792234-52792256 ATTGCCAAATGTCTCCTGGGAGG - Intergenic
1117222814 14:53622660-53622682 ATTCACAAATGTCTCTTGGATGG + Intergenic
1117245871 14:53886181-53886203 ATTGCCAAATGTGCCCTGGTGGG + Intergenic
1117515107 14:56492942-56492964 ATTGCCAAATGTCCCCTGGGTGG - Intronic
1117549709 14:56822406-56822428 ATTGCCAAATGTCCCCTGGGGGG - Intergenic
1117654052 14:57936516-57936538 ATTGTCAAAAGTTCCCTGGGGGG - Intronic
1117959954 14:61153080-61153102 ATTGCCAAATGTCCCCCGAGGGG + Intergenic
1118072450 14:62260745-62260767 ATTGCCAAATATCCCTTGGGAGG + Intergenic
1118286525 14:64479396-64479418 ATCGTCAAATGTCTCTATGGGGG + Exonic
1118389788 14:65286639-65286661 ATTGCCAAATGTCCCCTAGGGGG + Intergenic
1118866050 14:69704507-69704529 CTTGTCAAATGCCTCCTGAATGG - Intronic
1119071609 14:71590954-71590976 ATTGCCAAATGTCTCTTAAGAGG + Intronic
1119164279 14:72479505-72479527 ATTGCCAAATGTCCCCTGGGTGG + Intronic
1119224314 14:72933185-72933207 ATTGCCAGATGTCCCCTGGTGGG + Intronic
1119545433 14:75468327-75468349 ATTGCCAAATGTCTCCTGGGAGG + Intronic
1119591492 14:75892496-75892518 ATTGCCAAATGTCTCCTGGGGGG - Intronic
1119669114 14:76505487-76505509 ATTGCAAAATGTCCCCTGGGGGG - Intergenic
1119677831 14:76569189-76569211 ATTGCCGAATGTCCCCTGTGGGG - Intergenic
1119798973 14:77425790-77425812 ATTGCCAAATGTCTCTTGAGGGG + Intergenic
1120063688 14:80014867-80014889 ATTGAAAAATGTCTACTGAGGGG - Intergenic
1120108611 14:80526079-80526101 ATTGTCAAATGTCCCCTGGAGGG - Intronic
1120309143 14:82807997-82808019 ATTTCCAAATGTCCCCTGGGAGG + Intergenic
1120771439 14:88384799-88384821 ATTGTGAAATATTCCCTGGGGGG - Intergenic
1121111381 14:91315442-91315464 ATTGCCAAATGTCCCTTGGGAGG + Intronic
1121582917 14:95044479-95044501 ACAGCCAAATGTCCCCTGGGGGG + Intergenic
1121668965 14:95693532-95693554 AATGCCAAATGCCTCCTGAGGGG + Intergenic
1121964473 14:98291260-98291282 ATTGTCCAATGTCACCTGAGGGG - Intergenic
1121986729 14:98514078-98514100 ATTGTTAAATATCCCCTGGAGGG - Intergenic
1122109527 14:99487456-99487478 ATTGCCAAATGTCCCCTGGGGGG + Intronic
1122295337 14:100702295-100702317 ATTGCTAAATGTCCCCTGGAGGG + Intergenic
1122302980 14:100742162-100742184 ATTGCCAAATGTCTCCTGGGGGG - Intergenic
1122447439 14:101780426-101780448 ATTGCCAAATGTCCCTTGGGGGG - Intronic
1122673584 14:103391100-103391122 ATTGTCAAATGTCCACTAGAGGG - Intronic
1123736270 15:23187282-23187304 ATTATCAGATGTTTCCTGGAGGG - Intergenic
1124286977 15:28410255-28410277 ATTATCAGATGTTTCCTGGAGGG - Intergenic
1124295724 15:28501372-28501394 ATTATCAGATGTTTCCTGGAGGG + Intergenic
1124434831 15:29638392-29638414 ATTGCCAAATGTCCCCAGAGTGG + Intergenic
1124446729 15:29740827-29740849 ATTGCCAGATGTTTCCTTGGGGG - Intronic
1124916943 15:33985106-33985128 ATTGGCAAATATCTCTTGTGAGG - Intronic
1124922640 15:34041236-34041258 ATTGCCAAATGTTCCCTGAGAGG + Intronic
1125240024 15:37563716-37563738 ATTGCCAAATGTCCTCTGGGTGG - Intergenic
1125379953 15:39077151-39077173 AATGCCAGATGTCTCCAGGGTGG + Intergenic
1125900944 15:43346524-43346546 ATTGCCAAGTGTCCCCTGGGGGG + Intronic
1126006828 15:44265961-44265983 ATTGCCAAAAGTCCCCTGAGGGG + Intergenic
1126087834 15:45025786-45025808 ATTTCCAAATGTCTCCTGGGTGG - Intronic
1126576911 15:50206260-50206282 ACTGCCAAATGTCTCTTGGCAGG + Intronic
1126601330 15:50430874-50430896 ATTGCCGAATGTGTCCTGGAAGG - Intronic
1126882840 15:53117668-53117690 ATTGCCAAATGTCCTCTGGGAGG - Intergenic
1126919459 15:53504836-53504858 ACTGTCAAATGTCTCCTGGAGGG - Intergenic
1127006284 15:54573682-54573704 ATTGCCATATGTCTCCTGAGGGG - Intronic
1127132481 15:55881970-55881992 TTTGTCAAATATCCCCTGGGTGG + Intronic
1127381444 15:58434034-58434056 ATTGCCAAGTGTCCCCTGGAGGG - Intronic
1127710460 15:61592116-61592138 ATTGCCAAATGTCCCCTGTGGGG + Intergenic
1127799615 15:62466512-62466534 ATTGCCAAATGTTCCCTGTGGGG + Intronic
1127990619 15:64113338-64113360 ATTTCCAAATGTCTTCTGGGGGG - Intronic
1128386596 15:67153590-67153612 ATTGCCAAATGTCCCCTGGGGGG - Intronic
1128390439 15:67179275-67179297 ATTGCCAGATGTCTTCTAGGGGG - Intronic
1128394884 15:67214534-67214556 ACTGCCAAATGTCCCCTGGGGGG + Intronic
1128476588 15:68002066-68002088 ACTGCCAAATGTCCCCCGGGTGG - Intergenic
1128697566 15:69780040-69780062 TTTGCCAAATGTCTCCTACGGGG - Intergenic
1128766940 15:70256965-70256987 ATCGCCAAATGTCACCTGGGGGG + Intergenic
1128875763 15:71199953-71199975 ATTGTCTGTTGTCTCCTGGTGGG + Intronic
1129033202 15:72633035-72633057 ACTGTCAAATATCCCCAGGGCGG + Intergenic
1129216682 15:74104195-74104217 ATTGTCAAATATCCCCAGGGCGG - Intronic
1129362854 15:75035215-75035237 ATTATCCAATGTCCCCTGGGAGG - Intronic
1129407992 15:75331890-75331912 ACTGTCAAATATCCCCAGGGCGG + Intergenic
1129471156 15:75754669-75754691 ACTGTCAAATATCCCCAGGGCGG + Intergenic
1129623002 15:77166549-77166571 ATTGTCAAATGTGCCCCGGGGGG + Intronic
1129733848 15:77948508-77948530 ACTGTCAAATATCCCCAGGGCGG - Intergenic
1129799572 15:78403848-78403870 ACTGCCAAATGTCCCCTGTGGGG - Intergenic
1129841736 15:78747495-78747517 ACTGTCAAATATCCCCAGGGCGG + Intergenic
1129876677 15:78979895-78979917 ATTGCCAAATGTCCACTAGGGGG - Intronic
1129899605 15:79136438-79136460 ATTTTCAAGTGTCTCCTGGTGGG + Intergenic
1129904382 15:79175913-79175935 GTGGTCAAATGTCCCCTGGGAGG - Intergenic
1129923605 15:79341798-79341820 ATTGTCAAATGTCTCCTCAGGGG - Intronic
1130008713 15:80129599-80129621 ATTGTCGAATGTCTGCTATGTGG + Intronic
1130192930 15:81753572-81753594 ATTGCCAGATGTTTCCTGGAGGG - Intergenic
1130265296 15:82396100-82396122 ATTTCCAAATGTCCCATGGGAGG - Intergenic
1130475574 15:84263434-84263456 ATTTCCAAATGTCCCATGGGAGG - Intergenic
1130482992 15:84377488-84377510 ATTTCCAAATGTCCCATGGGAGG - Intergenic
1130506716 15:84550782-84550804 ATTTCCAAATGTCCCATGGGAGG + Intergenic
1130614198 15:85388847-85388869 AATGTCAGATGTCTCCTTGGGGG + Intronic
1130756532 15:86770323-86770345 ATTGCCAAATGTCTCCTGTGCGG - Intronic
1130898371 15:88188334-88188356 ATTGTCAAATGTCTGCTGGGGGG - Intronic
1130913434 15:88286637-88286659 ATTGTCAAATGTCTCCTGAAGGG - Intergenic
1131297718 15:91166263-91166285 CTTGTCAGATGTCTCTGGGGAGG + Intronic
1131305288 15:91237392-91237414 ATTGCTAAATGTCCCCTGGGGGG + Intronic
1131393585 15:92069120-92069142 ATTGGCAAATGTCCCCTGGGGGG - Intronic
1131414586 15:92243101-92243123 GTTGCCAACTGTCCCCTGGGTGG + Intergenic
1131549631 15:93345884-93345906 ATTGACAAATGTCTTCTGCAGGG + Intergenic
1131712457 15:95070976-95070998 ATTGCCAAATGTCTCCAGGGTGG - Intergenic
1131922585 15:97345810-97345832 ATTGCCAAATGTCTGCTGGAAGG + Intergenic
1132318616 15:100908930-100908952 GTTGTCATATGCCTCCTGGGAGG - Intronic
1132439539 15:101845452-101845474 ATTGCTAAATGTCCCCTGGGAGG + Intergenic
1133140879 16:3743110-3743132 ATTGCCAGATGTCCCCTGGAGGG - Intronic
1133388447 16:5389484-5389506 ATCGCCAAATGTCCTCTGGGAGG + Intergenic
1133426835 16:5699553-5699575 ATTGCCAAATGTCTGCTTGGGGG + Intergenic
1133626142 16:7572415-7572437 GGATTCAAATGTCTCCTGGGAGG - Intronic
1133864895 16:9633293-9633315 ATGGCCAAATGTCCCCTGGGAGG - Intergenic
1134103986 16:11472132-11472154 ATTACCAAATGTCTCCTGGGGGG + Intronic
1134229843 16:12420181-12420203 ATTGACACATGTCACCTGGGAGG + Intronic
1134289987 16:12896707-12896729 GTTGCCAAATGTCCCCTGAGGGG - Intergenic
1134357871 16:13501139-13501161 ATTCCCAAATGTTTCCTGGGAGG - Intergenic
1134360326 16:13524965-13524987 GTTGCTAAATGTCTCCTGGGTGG + Intergenic
1134416651 16:14049018-14049040 ATTGCCAAATGTCCCCTGGGAGG - Intergenic
1134568804 16:15274124-15274146 ATTGCCAAATGTCCCCTGAGGGG - Intergenic
1134649690 16:15898718-15898740 CTTCTCAAATGTATCTTGGGGGG + Intergenic
1134654752 16:15939732-15939754 GTTGCCAAATGTCCCCTGGGAGG - Intergenic
1134662322 16:15993469-15993491 ATTGCCAAATATCTCCAGAGAGG - Intronic
1134665530 16:16015826-16015848 ACTGCCAGATGTTTCCTGGGAGG + Intronic
1134676658 16:16095378-16095400 ATTGCCAACTGTCCCCAGGGTGG - Intronic
1134733631 16:16482238-16482260 ATTGCCAAATGTCCCCTGAGGGG + Intergenic
1134834814 16:17352154-17352176 ATTGTCAGATGTCTCCTTGGCGG + Intronic
1134872122 16:17661554-17661576 ATTGTCAAATATTTCCTAGGGGG - Intergenic
1134933870 16:18230044-18230066 ATTGCCAAATGTCCCCTGAGGGG - Intergenic
1135078648 16:19415367-19415389 ATGGGCAAATATCCCCTGGGAGG - Intronic
1135187160 16:20324984-20325006 ATTGCCAAATGTCTTCTTGGGGG + Intronic
1135232868 16:20725996-20726018 ACTGCCTAATGTCTCCTGGGGGG + Intronic
1135281573 16:21157871-21157893 ATTGCCAAATGTCCCCTGGAAGG - Intronic
1135336814 16:21608602-21608624 ATTGCCAAATGTCCCCTGGGAGG - Intronic
1135484484 16:22852068-22852090 ATTGCCAAATGTTTCCTGATAGG - Intronic
1135589400 16:23694514-23694536 ATTGCCTAATGTCCCCTGGGTGG + Intronic
1136106650 16:28034837-28034859 ATTGACAAATGTCCCTGGGGTGG + Intronic
1136107331 16:28039333-28039355 ATTGCCAAATATCTCTTGGGAGG - Intronic
1136353685 16:29729346-29729368 ATTCCCAAATGTCCTCTGGGTGG - Intergenic
1137339979 16:47591957-47591979 ATTGTCAAATGTCTCCTGGAGGG - Intronic
1137643641 16:50055878-50055900 ATTGCCAAATGTCCTCTGGGAGG - Intergenic
1137771767 16:51021676-51021698 ATTGCCAAATGTCACTTGGAAGG - Intergenic
1137956188 16:52832449-52832471 GTTTCCAAATGTGTCCTGGGAGG + Intergenic
1137959881 16:52871818-52871840 ATAGCCAAAGGTCCCCTGGGAGG + Intergenic
1138104217 16:54278819-54278841 ATTGTCAGATGTCCCCAGGGAGG + Intergenic
1138219170 16:55236492-55236514 ATTGCCAAATGTCCCCTGGGGGG + Intergenic
1138224605 16:55281965-55281987 AGTGGCAAATGTGTCCTGTGAGG - Intergenic
1138628792 16:58276575-58276597 ATTGCCAAATGTCCCCTTGGGGG + Intronic
1138726821 16:59149288-59149310 GTTCTCAAATGTCCCCTGGAGGG + Intergenic
1138911042 16:61399169-61399191 ATCGTCATATGTCTCTTGGGGGG + Intergenic
1139038707 16:62978360-62978382 ACTGTCAGATGTCTGCTGGGTGG + Intergenic
1139136042 16:64206147-64206169 ATTGTCAAATGTCAGCTGCAGGG + Intergenic
1139802323 16:69533252-69533274 ATTGCCAAATGTCCCCTGCGGGG + Intergenic
1140036155 16:71372780-71372802 ATTGCCAAATGTCCCCCTGGTGG + Intronic
1140267826 16:73435621-73435643 ATTGTCAAATGTTCCCTGAAGGG + Intergenic
1140503407 16:75454249-75454271 ATTGTCAAATGTCCCCAAGGGGG + Intronic
1140686405 16:77437634-77437656 ATTTCCAAATGTTTCCTGGTGGG + Intergenic
1140687563 16:77448299-77448321 ATTGCCATATGTTCCCTGGGTGG - Intergenic
1140700196 16:77574555-77574577 ATGGCCAAATTTCCCCTGGGGGG + Intergenic
1140734799 16:77888730-77888752 ATTGTCAAATGTCTCCTGGGTGG + Intronic
1140885327 16:79237832-79237854 ACTGACAAATGTCCCATGGGGGG + Intergenic
1141101129 16:81198306-81198328 ATTGCCAAATGTCCCCTGGGGGG - Intergenic
1141219390 16:82055087-82055109 ATTGTCAAATGTTCCCTGGGGGG + Intronic
1141269582 16:82526791-82526813 ATTGGCAAATGTCTCCTGATGGG + Intergenic
1141284604 16:82659916-82659938 ATTGTCAAGTGTCTCCTGGAGGG + Intronic
1141405875 16:83792500-83792522 CATTTCAACTGTCTCCTGGGAGG - Intronic
1141742777 16:85905104-85905126 ATTGCCAAATATCTCCTGGTGGG + Intronic
1143298826 17:5893587-5893609 ATTCCCAAATGTCTCTTGGGAGG - Intronic
1143406253 17:6678914-6678936 ATTGCCAAATGTCCCCTGGAAGG - Intergenic
1143874117 17:9979043-9979065 ATTGCCGAATGTCCCCTGGTAGG + Intronic
1144085541 17:11805149-11805171 ATTGCCCCATGTCTCCTGTGGGG - Intronic
1144319562 17:14101013-14101035 AATGCTAAATGTCCCCTGGGGGG + Intronic
1144487129 17:15676229-15676251 GTTGCCAAATGTCCCCCGGGGGG + Intronic
1144866162 17:18337348-18337370 AAAACCAAATGTCTCCTGGGCGG + Intronic
1144913902 17:18706086-18706108 ATTGCCAAATGTCCCCTGGGGGG - Intronic
1146231520 17:31115128-31115150 ATTGCCAAATGTCCCCTGGGAGG - Intronic
1146573201 17:33970227-33970249 ATTATCAAATGTCCCCTGGGTGG + Intronic
1146640582 17:34537807-34537829 ATTGCCAAATGTCCCTTGGGGGG - Intergenic
1146720092 17:35118138-35118160 ATGGCTAAATGTCCCCTGGGAGG - Intronic
1146739599 17:35270834-35270856 ATCGCCAAATGTCCCTTGGGGGG + Exonic
1146820674 17:35981751-35981773 ATTGTCCAAGGTCACCTGGGTGG + Intergenic
1147640650 17:41996863-41996885 ATTGCTAAATGTCCCCTGGAGGG - Intronic
1147863170 17:43535760-43535782 ATTACCAAATGTCTCTTGGGAGG + Intronic
1148248924 17:46056959-46056981 ATTGCCAAATGTCTCCTGTGAGG + Intronic
1148250925 17:46079373-46079395 AGAGTCAGATGTTTCCTGGGTGG - Intronic
1148886674 17:50778451-50778473 GTTGTCAAATGTCCTCTGGAGGG + Intergenic
1148979733 17:51562177-51562199 ATTGCCAAATATTCCCTGGGTGG - Intergenic
1148992863 17:51681600-51681622 ATTGCCAAATGTCCCCTGAAAGG + Intronic
1149113139 17:53059014-53059036 ACTGTCAAATCTATCCTGTGAGG + Intergenic
1149250702 17:54765787-54765809 ATTGCCAAATGTCCTCTGTGGGG - Intergenic
1149327718 17:55549325-55549347 ATTGGCAAATGTCCTCTAGGGGG + Intergenic
1149439474 17:56662758-56662780 ATTTCCAAATGTCTCCAGGTGGG + Intergenic
1149737551 17:59010210-59010232 ATTGCCACATGTTTCCTGGGAGG - Intronic
1150158101 17:62870980-62871002 CTTGCCAAAGGTCACCTGGGGGG - Intergenic
1150312624 17:64141355-64141377 ATTGCCAAATGTTCCCTGGATGG + Intergenic
1150314000 17:64153394-64153416 ATCGGCAAATGTCCTCTGGGGGG + Intronic
1150383676 17:64740603-64740625 TTTGTCAAATGTCATCTTGGGGG + Intergenic
1150625617 17:66839298-66839320 ATTGCCAAAAATCCCCTGGGAGG + Intronic
1150649971 17:67003709-67003731 TTTGTCAAATGTCACCTGGGAGG + Intronic
1150658079 17:67053591-67053613 ATCGCCAAGTGTCCCCTGGGGGG + Intronic
1150837484 17:68577452-68577474 ATTGCCAAATGTCCCCTGAGGGG - Intronic
1150858959 17:68780775-68780797 ATTGCCAAATGTTCCCTGGGAGG + Intergenic
1150877602 17:68986724-68986746 ATTGTTAAATATCCCCTAGGAGG - Intronic
1150966875 17:69980718-69980740 ATTGTCAAATGGCCCCTGGGGGG + Intergenic
1151026150 17:70679364-70679386 ATTGTCAAACATCCCCTCGGGGG - Intergenic
1151099829 17:71544217-71544239 ATTGCCAAATGTCCCCTGAGAGG + Intergenic
1151124704 17:71832258-71832280 ATTGTCAAATGTCCTCTGGGGGG - Intergenic
1151131333 17:71900090-71900112 ATTGTTGAATGTCTCCTGGAGGG - Intergenic
1151145859 17:72040388-72040410 ATTTCCAAGTGTCCCCTGGGAGG + Intergenic
1151227990 17:72660887-72660909 ATGGCCAAATGTCTCCGGGGAGG + Intronic
1151363557 17:73603130-73603152 AGTGTCACATGTCCCCTGGAGGG + Intronic
1151431631 17:74067454-74067476 ATTGCTAAATGTTTCCTTGGAGG + Intergenic
1151433786 17:74081764-74081786 ATTGCCAAACATCTCCGGGGGGG - Intergenic
1151461387 17:74256256-74256278 ATTGCCAAATGTCCCCAGGGGGG - Intronic
1151485853 17:74399327-74399349 ATTGCCAAATGTCCCATGGGAGG - Intergenic
1151494837 17:74453207-74453229 AATGTCCACTGTCTACTGGGTGG + Intergenic
1151713400 17:75819282-75819304 CTTGACAAATGTCCACTGGGTGG - Intronic
1152079361 17:78176888-78176910 GTTGTGAGATGTCCCCTGGGTGG + Intronic
1152681615 17:81671481-81671503 ATTGTCAGATGTTCCCTGGCAGG + Intronic
1153236986 18:2997640-2997662 ATTGTTTAATGACTCCTGTGGGG + Intronic
1153284088 18:3441563-3441585 ATTGTCAAATGTTCCCTGGAAGG + Intronic
1153675681 18:7454220-7454242 ATTGCCAAATGTCCCTTGGAGGG + Intergenic
1153744292 18:8161656-8161678 ATTTTTAAATGTCTCCTGCTTGG - Intronic
1154962362 18:21322324-21322346 ATTGCTAGATGTCCCCTGGGTGG - Intronic
1155110498 18:22709637-22709659 AGTGTCAAATGGAACCTGGGTGG - Intergenic
1155128868 18:22909947-22909969 ATTGCCAAATGTCCCCTGTGGGG + Intronic
1155312650 18:24539185-24539207 ATTGCCAAATGTCCTCTGGGAGG - Intergenic
1155469597 18:26177201-26177223 ATTGTCAAATGTCTTTTAGGTGG - Intronic
1155581046 18:27306540-27306562 ATTGCTAAATGACCCCTGGGAGG - Intergenic
1156862708 18:41856717-41856739 ATTGCCAAGTGTCTCCTGGCTGG + Intergenic
1156925221 18:42569214-42569236 ATTGTCAAATATGCCCTGAGAGG + Intergenic
1157130609 18:45003933-45003955 ATTGCCAAAAGTCTCCTGGTGGG - Intronic
1157157212 18:45280028-45280050 ATTGCCAAATGTCCCCTGGTGGG + Intronic
1157214282 18:45769833-45769855 ACGGTCAACTGCCTCCTGGGAGG - Intergenic
1157271351 18:46278772-46278794 ATTGCCAAATATTTACTGGGGGG - Intergenic
1157367822 18:47082357-47082379 ATTGCCATATGTTTCCTTGGAGG + Intronic
1157515936 18:48311435-48311457 ATTGCCAAATGTCTCCTGGGAGG - Intronic
1157597751 18:48874253-48874275 AATTTCAAAGCTCTCCTGGGTGG - Intergenic
1157644254 18:49251095-49251117 ATTGTCAAATGTCCCCTGGGGGG + Intronic
1157676723 18:49574036-49574058 ATTTCCAGATGTCCCCTGGGGGG + Intronic
1157775385 18:50391418-50391440 ATGGTAAAATGTCTCCTGGTAGG - Intronic
1157780219 18:50431822-50431844 ATTGCCATATATCCCCTGGGTGG - Intergenic
1157872298 18:51241702-51241724 ATTGCCAAATGTCCCCTCTGAGG - Intergenic
1157882250 18:51331589-51331611 ATTGCCAAATGTCCCATGGTGGG + Intergenic
1157998936 18:52593809-52593831 ATTGGCAATTGTCCCCTGAGGGG + Intronic
1158101994 18:53840261-53840283 ATTGCCAAGTGTCCCCCGGGGGG + Intergenic
1158325516 18:56309661-56309683 ATTGCCAAATATCCCCTGGGAGG - Intergenic
1158724079 18:59952492-59952514 ATTGTCAAATGTATCCCCAGGGG + Intergenic
1158728235 18:59994471-59994493 CATGTCAAATGCCACCTGGGAGG + Intergenic
1159004235 18:62998599-62998621 ATTGCCAGATATCCCCTGGGAGG + Intergenic
1159466651 18:68791913-68791935 ATTGCCAAATATCCCCTGAGAGG - Intronic
1159888977 18:73936764-73936786 GTTGCCAAATGTCCCCTGGGGGG - Intergenic
1160052697 18:75450659-75450681 ATTGCCAAATGTCCCCTGGAAGG - Intergenic
1161142310 19:2654928-2654950 ATTGTCCAGTGTCCCCTGGGAGG + Intronic
1161262119 19:3343874-3343896 ATTGCCAAGTGTCCCCTGGGGGG + Intergenic
1161408821 19:4104966-4104988 AGTGCCAGGTGTCTCCTGGGAGG + Intronic
1161474353 19:4475808-4475830 ATTGCCCAGTGTCCCCTGGGTGG + Intronic
1161520407 19:4720623-4720645 ATTGTCCAGTGTCCCCTGAGGGG - Intronic
1161605719 19:5213817-5213839 AATAACAAATGTCTCCTGGATGG + Intronic
1161652086 19:5491688-5491710 ATGGTCAAGTGTCCCTTGGGGGG - Intergenic
1161834358 19:6635591-6635613 GTTGCCAAATGTTTCCTGGAAGG - Intergenic
1161859730 19:6789067-6789089 ATTGCCAAATGTCCCCTGGGAGG + Intronic
1161860289 19:6792773-6792795 ATTGCCAAATGTCCCCTGGGAGG - Intronic
1161938066 19:7384313-7384335 ATGGCCAAAAGTCTCCTGGGGGG + Intronic
1161999350 19:7733236-7733258 ATAGCCAAATGTCCCCTGGTGGG - Intronic
1162044337 19:7988635-7988657 ATTGCCGCATGTCCCCTGGGAGG - Intronic
1162440699 19:10690406-10690428 ATTGCAAAATTTCCCCTGGGAGG - Exonic
1162483945 19:10947020-10947042 ATTGTGAAATATTTCCAGGGAGG - Intergenic
1162563710 19:11433381-11433403 ATTGCCAAATGGCCCCTGTGGGG + Intronic
1162846992 19:13400647-13400669 ATTGCCAAATGTCCCCTGGGAGG - Intronic
1162859285 19:13493472-13493494 ATTGCCAAAAGTCCCCTTGGGGG + Intronic
1163110497 19:15158041-15158063 ATTGCCAATTGTCATCTGGGAGG - Intergenic
1163298780 19:16430011-16430033 ATTGCCCAATGTCCCCTGGGGGG + Intronic
1163349198 19:16764758-16764780 ATTGTCAAGTGTCCCCTGGGGGG - Intronic
1163399496 19:17083517-17083539 ATGGCCAAGTGTCTCCTGGAGGG + Intronic
1163417896 19:17197671-17197693 ATTGCCAAGTGTCCCCTGGCAGG + Intronic
1163874795 19:19858957-19858979 ATAGTGCAGTGTCTCCTGGGAGG - Intergenic
1164023231 19:21327624-21327646 ATAGTGTAATGTCTCCTGAGAGG - Intronic
1164474516 19:28564915-28564937 ATTGCCAAATGTCCCCTAGGGGG + Intergenic
1164631589 19:29765435-29765457 ATTGTCACATGTGCCCTGGGGGG - Intergenic
1166275794 19:41753006-41753028 ATTGCCAAATGTCTCCTTGAGGG + Intronic
1166280959 19:41792928-41792950 ATTGCCAAATGTCCCCTGGGCGG + Intergenic
1166423103 19:42653483-42653505 AATCTCTTATGTCTCCTGGGAGG - Intronic
1167560154 19:50222135-50222157 ATTGCCAGGTGTCTCCTGGCGGG + Intronic
1167789548 19:51665004-51665026 CTTGCCAAATGTCCCCTGGGGGG + Intergenic
1167803957 19:51766269-51766291 ATTGTCAAAGGTCCCCTCGGAGG - Intronic
1167807436 19:51798242-51798264 ATTGTCAAAGATCCCCTGGGAGG - Intronic
1167809998 19:51821342-51821364 ATTGTCAAAGGTCCCGTGGGAGG - Intronic
1168243867 19:55100284-55100306 GTGGCCAAATGTCCCCTGGGGGG - Intronic
1168318376 19:55494101-55494123 ACTGTCCAATGTCCCCTTGGGGG - Intronic
1168374128 19:55861176-55861198 ATCCCCAAATGTCCCCTGGGGGG + Intronic
1168490561 19:56805237-56805259 ATTGCCACATGTCCCCTGGAGGG + Intronic
926868397 2:17385625-17385647 ATTGGCATAGGTCTCCTGGGGGG - Intergenic
927247539 2:20969644-20969666 ATTGCCAAATGGTTCTTGGGGGG - Intergenic
928715190 2:34051966-34051988 ATTGCCAAATGTCCCATAGGGGG + Intergenic
928843953 2:35645953-35645975 ATTGCCAAATGTCTCTTGGGTGG - Intergenic
929085821 2:38166329-38166351 ATTTTCAAATGCCACCTAGGAGG + Intergenic
929274247 2:40008231-40008253 ATTGCCAAATGTCCCCTAGCGGG - Intergenic
929356346 2:41029281-41029303 ATTGTCAAATGTCCCCTAGTAGG + Intergenic
929579580 2:43073274-43073296 GTTGTCAAAAATCACCTGGGAGG - Intergenic
929827049 2:45317014-45317036 ATTGTAAAATATCTCCTGGGAGG - Intergenic
929953132 2:46432405-46432427 ATTGTTGAATGTCTCTTGGGGGG - Intronic
930330471 2:49977282-49977304 ATTGTCAAATGTTCCCTGGGGGG - Intronic
930388790 2:50734041-50734063 GTTGTCAAATGTCCCTTGGGGGG - Intronic
930625483 2:53692139-53692161 ATTGCCAAATGTCTACAGGGGGG + Intronic
930693243 2:54386026-54386048 ATTGCCAAATGTCCTCTGGGGGG - Intergenic
930851803 2:55969110-55969132 TTGGTCAGTTGTCTCCTGGGTGG + Intergenic
930907889 2:56594931-56594953 ATTGCCAAATGTCCCCTGGGAGG + Intergenic
930915020 2:56676184-56676206 ATTGGCAAATATTCCCTGGGAGG + Intergenic
931525708 2:63150318-63150340 ATTGCCAAATGTCTCCTGGGGGG - Intronic
931771987 2:65505394-65505416 ATTGCCAAACGTCCCCTGGGAGG - Intergenic
931802709 2:65774134-65774156 ATTGCCAAGTGCCCCCTGGGAGG - Intergenic
931906464 2:66848796-66848818 ATTACCAAATGTTCCCTGGGTGG - Intergenic
932177556 2:69616695-69616717 ATTGCCAAGTGTCTCCTGGGGGG + Intronic
932179395 2:69632303-69632325 ATTGCTAAATGTCACCTGTGGGG - Intronic
932277809 2:70464473-70464495 ATTGTCAAATGTCCTCTGCAGGG - Intronic
932639680 2:73431189-73431211 ATTGTCAAATGTCCCTTGATGGG + Intronic
932985061 2:76716094-76716116 ATTGACAAATGTCCCTTTGGTGG - Intergenic
933200157 2:79438624-79438646 ATTGCCAAATGTCCCCTCAGAGG + Intronic
933227731 2:79770055-79770077 ATTGTCAAATGTCCCCTGGAGGG - Intronic
933798324 2:85939216-85939238 ATTACCAAATGTCCCCTGGAGGG + Intergenic
933918745 2:87023106-87023128 AATGTGAAATGTCTCTTAGGGGG + Intergenic
934004250 2:87746809-87746831 AATGTGAAATGTCTCTTAGGGGG - Intergenic
934930775 2:98420920-98420942 TTTGTCAACTGTCTTCTGGCTGG - Intergenic
935050215 2:99518838-99518860 ATTGCCAAATGTCTCCTGAGGGG - Intergenic
935191670 2:100782937-100782959 ATTCTCAAAATTATCCTGGGTGG + Intergenic
935262095 2:101364410-101364432 ATTGCCAAATGTCCCTGGGGAGG + Intronic
935767208 2:106380823-106380845 AATGTGAAATGTCTCTTAGGGGG - Intergenic
936086949 2:109475743-109475765 GTTGCCAAATGGCTCCTCGGGGG + Intronic
936411179 2:112259669-112259691 ATTGCCAAATGTCCTCTGCGGGG + Intergenic
936556102 2:113499813-113499835 ATTGTCGAACATGTCCTGGGAGG - Exonic
937500336 2:122471604-122471626 ATTTTCAACTGTTTCCTGGATGG - Intergenic
937880846 2:126863429-126863451 ATTGCCAAATGTCTCCTGCAGGG + Intergenic
938786120 2:134631480-134631502 ATTGCCAGACGTCCCCTGGGGGG + Intronic
938985423 2:136570757-136570779 ATTGCCAAATGTTCCTTGGGGGG + Intergenic
939059553 2:137403782-137403804 ATTGCCAAATGTTCCCTTGGGGG - Intronic
939338134 2:140858057-140858079 ATTCCCAAATGTTTCTTGGGAGG - Intronic
939563491 2:143759163-143759185 ATTGCCAAATCTCTCATAGGTGG + Intronic
939661012 2:144889716-144889738 TTTGCTAAATGTCCCCTGGGAGG + Intergenic
939678149 2:145097561-145097583 ATTGCCAAATGTCCCCAGTGGGG - Intergenic
939787394 2:146534048-146534070 GTTGCCAAATGTCTCCTGGAGGG + Intergenic
939885650 2:147678461-147678483 ATTGCCAAATGTCTGCTGTGGGG + Intergenic
940143220 2:150518403-150518425 CCTTTCAAATGTCTCCTCGGTGG + Intronic
940649634 2:156428678-156428700 ATTGTAAAATTTCTCCTTGATGG + Intergenic
940677284 2:156740024-156740046 ATTGCCAAATGTCCCTTGGGAGG - Intergenic
941048206 2:160700469-160700491 ATTTTCAAATATTTTCTGGGTGG + Intergenic
941666787 2:168250276-168250298 ATTGCCAAATGTCCCCTGGAGGG + Intergenic
941880748 2:170477760-170477782 GTTGTCAAATGTCTCCTGAGGGG + Intronic
942369207 2:175263656-175263678 AATGTCAAATGTCTTATGGTTGG + Intergenic
942609240 2:177725495-177725517 ATTGTCAAATTTCTCTAAGGAGG - Intronic
943553142 2:189366352-189366374 ATTGCCAATTGTCCCCTGAGGGG - Intergenic
943576166 2:189633510-189633532 TTTGCCAAATGTCCCCTAGGGGG - Intergenic
943614414 2:190076347-190076369 ATTGCCAAAAGTTTTCTGGGGGG + Intronic
943760685 2:191605235-191605257 ATTGCCAAATGTCCTCTGGGAGG + Intergenic
944322016 2:198357152-198357174 ATTGACAAATGTCCTCTGGAGGG + Intronic
944513963 2:200492326-200492348 ATTGTCAAATATCCCCTGGAAGG + Intronic
944705760 2:202286750-202286772 ATAGACAAATGCCTACTGGGGGG - Intronic
944816012 2:203376196-203376218 ATTGCCAAATGTCCCCTTGGGGG - Intronic
944916171 2:204362886-204362908 ATTGCCAAATGTTCTCTGGGAGG + Intergenic
945150304 2:206783839-206783861 CTTGCCAAATGTCCCCTGGGAGG - Intronic
945296477 2:208176149-208176171 TTTGCCAAATGTCCCCAGGGAGG - Intronic
945337457 2:208609421-208609443 ATAGTCACATGGCCCCTGGGAGG - Intronic
945439958 2:209866380-209866402 ATTGTCAAATGTTCCCTGATGGG - Intronic
945592203 2:211747377-211747399 ATTATCAAATGTCTCCTGTGGGG + Intronic
945707621 2:213255279-213255301 ATTGTCCAATGTCTCCTGGAGGG + Intergenic
945903696 2:215567297-215567319 ATTGTCAAATGTCTCCTGAAGGG + Intergenic
946101264 2:217326486-217326508 ATTGCCAAATGTCCCCTGAGGGG + Intronic
946102398 2:217337251-217337273 ATTGCCAAATGTCCCCTGATGGG - Intronic
946235129 2:218319781-218319803 ATTGCCATATATCTTCTGGGAGG + Intronic
946352271 2:219162897-219162919 ATTGCCAAATGTCCCCATGGGGG + Intronic
946667340 2:222064877-222064899 TTGGTCAAATTTCTTCTGGGTGG - Intergenic
946854526 2:223939847-223939869 ATTACCAAATGTTCCCTGGGTGG + Intronic
947003559 2:225485981-225486003 ATTGCCAAATGTCTCCTTGTGGG + Intronic
947150891 2:227114194-227114216 ATTACCAAATGTCCCCTGGGGGG - Intronic
947340535 2:229134073-229134095 ATTGCCAGATGTCCCCTGCGTGG + Intronic
947378088 2:229517696-229517718 ATTGCCAAATGTCTTCTGGGAGG - Intronic
947831192 2:233142980-233143002 ATTGCCAAATGTCCCCTGGAGGG + Intronic
948025168 2:234770852-234770874 ATTACCAAATTTCTCCTGTGGGG - Intergenic
948413331 2:237781852-237781874 ATTGCCAAATGTCCACTGCGGGG + Intronic
948471934 2:238187958-238187980 ACTGACAAATGTCCCCTGGGCGG + Intronic
1169708570 20:8535585-8535607 TTTGCCAAATGTCCACTGGGGGG - Intronic
1169749818 20:8980592-8980614 ATGGCCAAATGTCCCCTGGAGGG - Intergenic
1169848281 20:10020844-10020866 ATTGTTAAATGCCTCCAGTGTGG - Intronic
1170504697 20:17013045-17013067 ACTGCCAAATGTCCCCTGGTGGG - Intergenic
1170555992 20:17515037-17515059 ACTGCCAAATGTCCCCTTGGGGG - Intronic
1170910487 20:20561957-20561979 ATTGCCAAATGTTCCCTGGAGGG + Intronic
1170934146 20:20795407-20795429 ATTGCCAAACGTCCCCTGGGAGG + Intergenic
1172041636 20:32050798-32050820 TTTGTAAAATGTCCCCTGGTGGG - Intergenic
1172186389 20:33033680-33033702 ATTGCCAAATGTCTTCTTGGAGG - Intronic
1172608881 20:36234636-36234658 ATTGCTAAATGTCCCCGGGGCGG - Intergenic
1173172400 20:40738028-40738050 ATTGCCAATTGTCTGCTCGGGGG - Intergenic
1173403554 20:42745515-42745537 ATTGCCAAATGTCCCCTGGAAGG + Intronic
1173591353 20:44227558-44227580 ATTGCCAAATGTCCCCTCAGGGG - Intergenic
1173619656 20:44427159-44427181 ATTGTCAAATGTCTCCTGATGGG + Intronic
1173659968 20:44726554-44726576 ATTGCCAAACCTTTCCTGGGAGG + Intronic
1173685828 20:44922787-44922809 ATTGCCAAATGTCCCCCAGGAGG - Intronic
1173739936 20:45392954-45392976 ATTGCCAAATATCCCTTGGGAGG + Intronic
1173764256 20:45592789-45592811 ATTGCCAAATGTCCCCTAGTGGG + Intergenic
1173803458 20:45909559-45909581 AGTGTCCAATGTCTCCTGCCAGG - Exonic
1173862028 20:46290293-46290315 ATTGCTAAATGTCCCCTGGGTGG - Intronic
1173865743 20:46311678-46311700 ATTGCCAAATGTCTCCTGAAGGG + Intergenic
1173914888 20:46699907-46699929 ATTGCCAAATATTCCCTGGGAGG - Intergenic
1173944946 20:46943120-46943142 GCTGTCAAATGTCCCCTCGGGGG - Intronic
1174082012 20:47977193-47977215 ATTGCCAAATGTCCTCTGGGGGG + Intergenic
1174134468 20:48369610-48369632 ATTGCCAAATGTCCTCTGGGGGG - Intergenic
1174192974 20:48753400-48753422 ATTGGCACATGTCTTCTAGGGGG - Intronic
1174276383 20:49407607-49407629 ATTGCCAAATGTCCCCTGGGGGG - Intronic
1174301931 20:49588782-49588804 ATTGCTAAATGTGTCCTGAGAGG + Intergenic
1174429941 20:50460502-50460524 ATTGCCAAATGTCCCCTGGGGGG - Intergenic
1174433026 20:50484575-50484597 ATTGTCAAATGGCCCCTGGGGGG + Intergenic
1174481354 20:50833545-50833567 GTTGCCAAATGTCCCCTGGGGGG + Intronic
1174588944 20:51630014-51630036 ATTGCCACATGTCTCCTGGAGGG - Intronic
1174605283 20:51757014-51757036 ATTGCCAAGTGTCCTCTGGGGGG - Intronic
1174612579 20:51810338-51810360 ATTGCCAAATGTCCCCTGGTGGG - Intergenic
1174622533 20:51887068-51887090 ATTGCCAAATGCCCCTTGGGAGG - Intergenic
1174683682 20:52432897-52432919 ATTTTCAAATGTCCCCTAGGAGG - Intergenic
1174684185 20:52437816-52437838 ATTGTTAGATGTTTACTGGGAGG + Intergenic
1174706198 20:52658727-52658749 ATTGCCAAATGTTTTCTGGAGGG - Intergenic
1174710077 20:52695272-52695294 ATTGCCAAATGTCTCCTGGGAGG - Intergenic
1174750311 20:53105439-53105461 ATTGCCAAATGTCTCTTGAGCGG + Intronic
1174775336 20:53338535-53338557 ATTGTCAACTGTCCCCTAGAAGG - Intronic
1174798735 20:53544559-53544581 ATTGCCATATGTCCCATGGGAGG + Intergenic
1174828081 20:53787131-53787153 ATTGCCAAACGTCCTCTGGGAGG + Intergenic
1174832565 20:53826343-53826365 GTTGCCAAATGTCTTCTGGTGGG + Intergenic
1174859515 20:54077403-54077425 ATTGCCAAATGACTCCTAGGGGG + Intergenic
1174870892 20:54181026-54181048 ATTATCAAATGGCTCCTGGTTGG + Intergenic
1174887486 20:54351904-54351926 ATTGTCACATTTTCCCTGGGTGG - Intergenic
1174905661 20:54547954-54547976 ATTGTCAAACATCCTCTGGGGGG - Intronic
1175112506 20:56658447-56658469 ATTGCCAAATGTCATCTAGGGGG - Intergenic
1175139963 20:56853720-56853742 ATTGGCAAATGTCCCCTGGGGGG + Intergenic
1175147753 20:56909671-56909693 GTTGCCAGATGTCTCCTGGAGGG + Intergenic
1175151760 20:56940491-56940513 ATTCCCAAATGTTTCCTGGCAGG + Intergenic
1175187902 20:57191010-57191032 ATTGCTACATGTCCCCTGGGAGG + Intronic
1175305502 20:57973200-57973222 ATTGTCAAATGCCCCCTGTGGGG + Intergenic
1175331343 20:58166771-58166793 AATGACAAATGTCACCTGGAAGG - Intergenic
1175364128 20:58439652-58439674 ATTGCCACATGTGTCCTGGAGGG + Intronic
1175413429 20:58786122-58786144 CTTGCCAAATGTCCCCGGGGGGG - Intergenic
1175538334 20:59730904-59730926 ATTGGCAAATGTCTTCTGTAAGG - Intronic
1175549333 20:59806459-59806481 ATCATCAAATGCCTCCTGGAGGG + Intronic
1175595702 20:60230957-60230979 ATTACAAAATGTCTCCTGGGGGG - Intergenic
1175613308 20:60370385-60370407 GTTGCCAAATGTCTCCTGGTTGG - Intergenic
1175636356 20:60587445-60587467 ATTGACAAGTGTCCTCTGGGAGG + Intergenic
1175657171 20:60780986-60781008 ATCACCAAATGTCCCCTGGGTGG + Intergenic
1175792642 20:61751313-61751335 ACTGCCAAATGTTCCCTGGGGGG + Intronic
1175816927 20:61887996-61888018 ATTTCCAAATCTGTCCTGGGAGG + Intronic
1177115452 21:17080379-17080401 TTTGTCAAATGTCTGCTAGCAGG - Intergenic
1177151292 21:17457829-17457851 ATGGCCAAATGTCCTCTGGGGGG + Intergenic
1177424330 21:20903098-20903120 ATTGCAAAATGTCCCCTGGAGGG - Intergenic
1178189008 21:30258559-30258581 ATTGCCAAATGTGTCCTAGGTGG - Intergenic
1178221141 21:30661511-30661533 ATTGTCAAATGCCCCCGGGGGGG - Intergenic
1178223477 21:30687613-30687635 ATTGACAAATGTCTCCTGGATGG + Intergenic
1178248314 21:30975548-30975570 ATTGCCAAATGTCCCCTGGAAGG + Intergenic
1178340159 21:31779200-31779222 ATTTTCAAATGTCCCCTTAGGGG + Intergenic
1178371981 21:32033964-32033986 ATTGTCAAATGTCCCCGGGGCGG + Intronic
1178849844 21:36204084-36204106 ATTGTCAAATGTACCCTGAGAGG - Intronic
1178902381 21:36607598-36607620 GTTGCCAAATGTCCCCTGGAGGG - Intergenic
1179167769 21:38947966-38947988 GGTGCCAAATGTCCCCTGGGGGG + Intergenic
1181882403 22:25991454-25991476 ATGACCAAATGTCCCCTGGGGGG + Intronic
1181908984 22:26222854-26222876 ATTGTCAGATATCTCCTGGTGGG - Intronic
1181916528 22:26285526-26285548 ACTGCCAGATGTTTCCTGGGTGG - Intronic
1181923214 22:26336821-26336843 ATTGCCAAATGTCACCTGTGAGG + Intronic
1182114519 22:27747922-27747944 ATTGCCCAATGTCTCCTTGGGGG - Intergenic
1182138081 22:27925097-27925119 ATTGCCTAGTTTCTCCTGGGGGG + Intergenic
1182338146 22:29598893-29598915 ATTGCCAAATGTCCCCTGTAGGG + Intergenic
1182653109 22:31868215-31868237 ATTACCAAATGTCCCTTGGGGGG - Intronic
1182656438 22:31894099-31894121 ATTGTCACATGTCCCCAGGAAGG + Intronic
1182782263 22:32877596-32877618 ATTGCCAAGTGTCCCCTGGGTGG + Intronic
1182792077 22:32961208-32961230 ATTGCCAAATGTCTCCTGTTGGG + Intronic
1182958190 22:34447006-34447028 GTTTCCAAATGTCTCCTAGGAGG + Intergenic
1183020514 22:35022693-35022715 ATTGCCAAGTGTTTCCTGGGGGG + Intergenic
1183141033 22:35939305-35939327 ATTTCCAAATGTCCCCTGGATGG + Intronic
1183258914 22:36781599-36781621 ATTGCCAAATGTCCCCTGGGGGG + Intergenic
1183805925 22:40210968-40210990 ATTGTCAGATGTCTCCTGAAGGG + Intronic
1184022332 22:41829134-41829156 ATTGCCAGATGTCCACTGGGAGG + Intergenic
1184079932 22:42212240-42212262 AATTGAAAATGTCTCCTGGGCGG - Exonic
1184315655 22:43686440-43686462 ATTGCCAGATATCTCCTGGGAGG + Intronic
1184616962 22:45644989-45645011 ATTGCCAAATGTCCCCTGCAGGG + Intergenic
1185065446 22:48629634-48629656 ATCATCAAATGTCCCCTGAGGGG - Intronic
949511034 3:4767372-4767394 ATTGCCAGTTGTCCCCTGGGCGG + Intronic
949908496 3:8879667-8879689 ATTGCCAGCTGTCTCCTGGGGGG + Exonic
950177482 3:10885465-10885487 ATTACCAAATGTCTCCTGGGAGG - Intronic
950394209 3:12721261-12721283 ATTGCCAAATGTTCCCTGGTTGG + Intergenic
950699672 3:14732581-14732603 ATTGTCAAATATCCCTTGGGGGG - Intronic
950760089 3:15214857-15214879 ATTGCCAAATGTCCCCTGGGGGG - Intronic
951013931 3:17708633-17708655 ATTGCCAAATGTCCCTTGAGGGG + Intronic
951218632 3:20046822-20046844 ATTGTCAAATGTCCCTTGGGAGG - Intronic
951382932 3:22007560-22007582 ATTGCCAAATTCCTCCTGAGAGG + Intronic
951580685 3:24159674-24159696 TTCGCCAAATGTCCCCTGGGAGG - Intronic
951610408 3:24486071-24486093 ATTATCAGGTGTCTACTGGGAGG - Intronic
951763081 3:26165674-26165696 ATTGCCAAATATCCCCTGAGGGG + Intergenic
952359491 3:32615525-32615547 ATTGCCAAATGTTCCCTAGGGGG + Intergenic
953144332 3:40260574-40260596 ATTGTCAAATATTCCCTGAGGGG - Intergenic
953294843 3:41704577-41704599 ATTGACATATGTCCTCTGGGTGG - Intronic
953847180 3:46436966-46436988 ATTGTCAAATATCCCCTCAGGGG + Intronic
954198408 3:49009612-49009634 ATTGCTAGATGTCTCCTGTGGGG + Intronic
954762974 3:52890429-52890451 ATTGCCAACTGCCCCCTGGGGGG - Intronic
954795407 3:53159054-53159076 ATTGCCAAATGTCTGCTGCAGGG - Intronic
955082035 3:55666579-55666601 ATTGCTGAATGTCCCCTGGGGGG - Intronic
955196440 3:56808759-56808781 AGTGCCAAATATCTGCTGGGAGG - Intronic
955312745 3:57905814-57905836 ATTGCCAAATGTCCCCTGGGAGG - Intronic
955376859 3:58404497-58404519 ATTGCTAAATGTCTCCTGGGGGG + Intronic
955419196 3:58719985-58720007 CTGGTTAAATGTCTCCTTGGAGG + Intronic
955703410 3:61704542-61704564 ATTGCCAGATGTCCCCTGGAGGG + Intronic
955761778 3:62292651-62292673 ATGGCCAAATGTCCCCTGGGGGG - Intronic
955775564 3:62428793-62428815 ATGGCCAAATTTCCCCTGGGGGG - Intronic
955943779 3:64171281-64171303 ATTGTCAAATATCTCTTGGGGGG - Intronic
955986854 3:64582589-64582611 GTTGCCAAATGTTCCCTGGGAGG - Intronic
956046267 3:65199379-65199401 ATTGTCAAATGTTTCCTTTTCGG + Intergenic
956102063 3:65778881-65778903 ATCCCCAAATGTCCCCTGGGGGG - Intronic
956174821 3:66462978-66463000 ATTGCCAAGTGTCCTCTGGGGGG - Intronic
956202304 3:66719149-66719171 ATTGCCAAATGTCCCCTGAAGGG - Intergenic
956217398 3:66862735-66862757 ATTGCAAAATGTCCCCTGGAGGG + Intergenic
956272357 3:67461746-67461768 ATTGCCAAATGTCCCCTGGGAGG + Intronic
956325819 3:68051436-68051458 TTTGTCAAATATCCCCTAGGTGG - Intronic
956349495 3:68319352-68319374 ATTGTCAAATGTCCCTGGGGTGG - Intronic
956387523 3:68735975-68735997 ATTGCCAAATGTCTACTCAGGGG + Intronic
956587290 3:70878259-70878281 ATTGCCAAATGTCTCCTGGGTGG + Intergenic
956620463 3:71216837-71216859 ATTGCCAAATGTCCCCTGGTGGG - Intronic
956700655 3:71955981-71956003 ATTGCCAAATGTCCCCTGTGGGG - Intergenic
956707924 3:72015351-72015373 ATTGTCAAATGCCCCCTGGAAGG + Intergenic
956756206 3:72389859-72389881 ATTGCCAAATGTTCCCTGGAAGG + Intronic
956852868 3:73246874-73246896 ATTGCCAGGTGTCTCCTGGGTGG + Intergenic
956891982 3:73622550-73622572 ATTGTCAAGTGTCCTCTGGAGGG - Intronic
956914173 3:73853191-73853213 ATTGCCTAATGCCCCCTGGGGGG + Intergenic
958842677 3:99227163-99227185 TTTGACAAATGCCTTCTGGGTGG + Intergenic
958898258 3:99854668-99854690 ATTGCCAAATGTCTCCTGGGGGG + Intronic
958963765 3:100536028-100536050 ATTGATAAATGTCACCTGGGGGG - Intronic
959005930 3:101019844-101019866 ATTACCAAATGTCCCTTGGGGGG - Intergenic
959136020 3:102422286-102422308 ATTGCCAAATGTCTCCTAGGGGG - Intronic
959500134 3:107097656-107097678 ATTGCCAAATGTCCACTGGTGGG - Intergenic
959503043 3:107128695-107128717 AATGAGAAATGTCACCTGGGTGG + Intergenic
960030948 3:113054357-113054379 ATTGTCAAATGTACCCTGGGGGG + Intergenic
960086363 3:113595602-113595624 ATTGCCAAATGTCTTTTTGGGGG + Intronic
960300532 3:115998094-115998116 ATTGACACACGTCTCCTGGGAGG + Intronic
960321140 3:116238074-116238096 ATTGCCAAATATTTCCTGGGGGG + Intronic
960466198 3:117998654-117998676 ATTGCCAAATGCCCCCTGGAGGG + Intergenic
960603744 3:119483827-119483849 ATGGCCAAATGTCCCCTGGGTGG + Intronic
961005717 3:123404106-123404128 TTTGTTAAATGTTTCCTGGGGGG - Intronic
961903815 3:130241712-130241734 ATTGTCAAATGTCCCCTGGAGGG - Intergenic
962167197 3:133061796-133061818 ATTATAAAATTTCTCCTTGGTGG - Intronic
962174843 3:133142096-133142118 ATTGTCATATATATTCTGGGGGG + Intronic
962250127 3:133830957-133830979 ATTGCCAAATGTCCCCTGTGGGG + Intronic
962923975 3:139975095-139975117 ATTCTAAAATGCCTCCTGGCTGG + Intronic
963335346 3:143969050-143969072 ATTGCCAACTGGCCCCTGGGAGG + Intergenic
963665755 3:148183992-148184014 ATTGTCAAATATCACCTGGAGGG + Intergenic
963842121 3:150118463-150118485 ATTGCAAAATGTCCCCTGAGGGG + Intergenic
964048614 3:152362706-152362728 ATTGCCAAATGTCCCATGGTAGG + Intronic
964054112 3:152431281-152431303 ATTGCCAGGTGTCTCCTGAGAGG + Intronic
964240756 3:154591314-154591336 ATTGCCAAATATTTCTTGGGGGG - Intergenic
964419528 3:156486643-156486665 AGTTACAAATGTCTCCTGTGTGG + Intronic
964534927 3:157710342-157710364 ATTGCCAAATGCCCCCTGGAAGG + Intergenic
965096809 3:164239841-164239863 ATTGACAAATGTCCTTTGGGTGG - Intergenic
965711666 3:171561814-171561836 ATTGCCAAATGTCCCCTCAGGGG + Intergenic
965817927 3:172656017-172656039 GTTGTCAAATGTCTGCAGAGAGG + Intronic
965818034 3:172656919-172656941 GTTGTCAAATGTCTGCAGTGAGG - Intronic
966280269 3:178218127-178218149 ATTGTCAAATGTCTACTATATGG - Intergenic
966326912 3:178766982-178767004 ATTTCCAAATGTCCCCTGGAGGG - Intronic
966490708 3:180525546-180525568 ATTGTCAAATGCTCCCTGGAGGG - Intergenic
966730391 3:183146139-183146161 ATTGTCAAATGTCTCCTAGGAGG - Intronic
966979351 3:185116599-185116621 ATTACCAAATGTCCCCTGGGTGG + Intronic
967892264 3:194371825-194371847 ATTGCCAAATGTCCCCAGGAAGG + Intergenic
968963235 4:3756270-3756292 ATTGCCAGATATCCCCTGGGGGG - Intergenic
969136973 4:5037227-5037249 ATTGCCAAATGTTTCCTGGGTGG + Intergenic
969700712 4:8766161-8766183 AGTGCCCACTGTCTCCTGGGAGG - Intergenic
969863410 4:10055484-10055506 ATTGCCAAATGTCCCCTGGGGGG + Intergenic
969923195 4:10560001-10560023 TTTGTCAAAAGTCCCCTGGGGGG + Intronic
970375466 4:15452569-15452591 ATTGCCAAATGTCTCCTGGGGGG + Intergenic
970500681 4:16673649-16673671 ATTGCCAATTGTTCCCTGGGAGG - Intronic
970664519 4:18321430-18321452 ATTCTCAAAGGACTCCTTGGAGG - Intergenic
971214652 4:24651864-24651886 ATTGCCAAATGTCCCACGGGAGG - Intergenic
971219804 4:24694424-24694446 ATTGCCAAATGTCCCTTGGAGGG + Intergenic
971363144 4:25955017-25955039 ATTGTCCAATGTCTCCTAGGAGG + Intergenic
971502481 4:27332026-27332048 ATTGTGAAATGTCCCCAAGGGGG - Intergenic
971936787 4:33160268-33160290 ATTGTGAAATGTCCTCTGGAGGG - Intergenic
972190345 4:36583860-36583882 ATCGTCAAATGTTCCCTGGGTGG - Intergenic
972271250 4:37512399-37512421 ATTTCCAAATGTTTCCTGTGAGG + Intronic
972464889 4:39345779-39345801 ATTGACAAATGCCTTCTGGGGGG - Intronic
972547847 4:40097996-40098018 ATTGTCATTTGTCCCCTGGGAGG + Intronic
972951672 4:44332916-44332938 ATTGTCAAATGTCTCCTCAAAGG + Intronic
973737933 4:53890895-53890917 ATTGCCAAATGTCTTCTGGCAGG + Intronic
974115426 4:57573326-57573348 ATTGTCAAATGTCCGGTTGGAGG - Intergenic
974118737 4:57612373-57612395 ATTGCCAACTGTCTCATGGTGGG - Intergenic
974394271 4:61314690-61314712 ATTGCCAAATGTCTCCAGAAGGG - Intronic
974823954 4:67103140-67103162 ACTGTCAGATGTCCCTTGGGAGG - Intergenic
975153026 4:71041857-71041879 ATTTTAAAATGTCTCTTGAGAGG + Intergenic
975283251 4:72587624-72587646 ATTGCCAAATGTCCCCTGAAGGG + Intergenic
975575783 4:75861123-75861145 ATTGCCAAATGTCCCCTGGAGGG - Intronic
975617141 4:76257711-76257733 ATGCTCAAATGTCTCCTGATTGG + Intronic
975651840 4:76601202-76601224 ATTGTTAAATGTCCCCTGGAGGG - Intronic
975776463 4:77792882-77792904 ATTGCCAAATGTCTCCTGAGGGG - Intronic
976173731 4:82331598-82331620 CTTGCCAAATGTCTCCTGGAGGG + Intergenic
976214686 4:82705094-82705116 ACAGTAAAATGTCCCCTGGGGGG - Intronic
976657646 4:87506110-87506132 ATTGCCAAATGTTCCATGGGGGG + Intronic
976705107 4:88011920-88011942 ATTGCCAAATGTCCCCTGAGGGG - Intronic
977415722 4:96730482-96730504 CTTGTCAAACGTCTTCTGGTCGG - Intergenic
977842523 4:101725852-101725874 ATTGTCAAATGTTCCCTTGGGGG - Intronic
977911385 4:102541191-102541213 ATTGACAAATGTCCCCTGGGGGG + Intronic
978317595 4:107456967-107456989 ATTGTCTAATGTCCCTGGGGAGG - Intergenic
978604417 4:110463796-110463818 ACTGCCAAATGTCCTCTGGGAGG + Intronic
978613118 4:110566209-110566231 ATTGCCAAATGTCCTCTGGGTGG + Intergenic
978768282 4:112427702-112427724 ATTGTCAATCGTGTCCTTGGTGG + Intronic
979130221 4:117035306-117035328 GTTGTCAAATGTCTCCTGTGGGG + Intergenic
979303051 4:119109198-119109220 ATTGTCAAATGTCCGTTGGGGGG + Intergenic
979438133 4:120719225-120719247 ATTGCCAAACGTCCCCTGGGGGG + Intronic
979601306 4:122589156-122589178 ATTGCCAAATGTCTCCTGAGGGG - Intergenic
979624471 4:122829284-122829306 ATTGTCAAATGTCCCCTGGGAGG - Intronic
980685926 4:136228302-136228324 ATTGTCAAATATCTCACTGGGGG + Intergenic
980857187 4:138454427-138454449 ATTGCCAAATGTCCCCTGGAAGG + Intergenic
981084704 4:140671185-140671207 GTTGCCAGATGTCTCCTGAGAGG - Intronic
981166890 4:141570447-141570469 ATTGCCATATGTCCCCTGAGGGG - Intergenic
981342320 4:143635572-143635594 ATTGCCAAATGTCCCCTGGGGGG + Intronic
981495520 4:145387442-145387464 ATTGCCAAATGTCCCTTGAGTGG + Intergenic
981536039 4:145800809-145800831 ACTGCCAAATGTCCCCTTGGGGG + Intronic
981579260 4:146235992-146236014 ATTGACAAAGGTCCCCTGGAGGG + Intergenic
981898161 4:149829279-149829301 GTTGCCAAATGCTTCCTGGGGGG - Intergenic
982011899 4:151113625-151113647 ATTGCCAAATGTCCCCTGGAGGG + Intronic
983111432 4:163755013-163755035 ATTGCCGAATGTCCCCTTGGGGG - Intronic
983275557 4:165613124-165613146 GTTGCCAAATATCCCCTGGGTGG + Intergenic
983551748 4:169025004-169025026 ATTGCCAAATGTCTCCTAGAAGG + Intergenic
983944069 4:173566828-173566850 ATTGCCAAATGTCTCCTAGGTGG - Intergenic
984630088 4:182051962-182051984 ATTGCCAAATGACCCCTGAGAGG - Intergenic
986430917 5:7680158-7680180 ATTGACAACTGTTTCCTGGGGGG - Intronic
986648143 5:9938593-9938615 ATTGCCAAATGTCTCCTGCATGG - Intergenic
986666851 5:10112142-10112164 ATTGTAAAATGTTCCCTGGTTGG - Intergenic
986727508 5:10610285-10610307 ATTGCCAAATGCACCCTGGGAGG - Intronic
986736501 5:10672102-10672124 AGTGTCAAATGTTCCCTGGGGGG + Intergenic
986761283 5:10882277-10882299 ATTGCCAAATGCCTCTGGGGTGG + Intergenic
986836094 5:11639077-11639099 ATTGTCAAATGTCTCCTGGAGGG - Intronic
986875860 5:12108169-12108191 ATTGTCAAATGTGTCCTAGAAGG - Intergenic
987006500 5:13715808-13715830 ATTGCCAAATGTCCTCTGGGGGG - Intronic
987240713 5:15995724-15995746 ATTGCCAAATGCCCCCTGCGCGG - Intergenic
987373547 5:17215480-17215502 ATCGCCAAATGTCTCCTGGGAGG - Intronic
987824805 5:23016785-23016807 ATTTTTAAATGTTTCCTGAGAGG - Intergenic
988468576 5:31514769-31514791 ATTGCCAAATGTCCCCTGGGGGG - Intronic
988518981 5:31929476-31929498 AGTGCTAAATGTCTCCTGTGGGG + Intronic
988557796 5:32253075-32253097 ATTGCCAAATGTCCCCTCGTGGG - Intronic
988699552 5:33659928-33659950 ATTGCCAAATGTCCCTTAGGAGG - Intronic
988812813 5:34802111-34802133 ATTGCCAAATGTCCCCTGGGGGG - Intronic
989106611 5:37868877-37868899 TTTGCCAGATGTCTCCTGAGGGG + Intergenic
989342030 5:40387018-40387040 ATTGCCAAATGTCTGCTAGGGGG - Intergenic
989544593 5:42658651-42658673 ATTGCCAAATGTCCCCTGGGGGG - Intronic
989962533 5:50433608-50433630 ATTGCCAAATGTCTCCTGCGGGG - Intronic
990174676 5:53093571-53093593 ATTGTCAAATGCCTCCTGGGGGG + Exonic
990205511 5:53424833-53424855 TTTGACAAATGTCCCCTGGGGGG - Intergenic
990386607 5:55270141-55270163 ATTGCCCAATGTCCCCTGGTAGG + Intronic
990487761 5:56276071-56276093 ATTGACATAGGTCTCCTGGGGGG + Intergenic
990615122 5:57500015-57500037 ATTGCCAAATATTTCCCGGGGGG + Intergenic
990905309 5:60796521-60796543 ATTGCCAAACGTCCCCTGTGGGG + Intronic
991466163 5:66914759-66914781 ATTGTCAAATGTCATCTTTGGGG - Intronic
991474214 5:67002897-67002919 ATTGCCAAATGTCCCTTGGGAGG - Intronic
991611882 5:68457947-68457969 ATGGCCAAATATCCCCTGGGAGG + Intergenic
992170941 5:74101472-74101494 TTTGCCAAATGTCCCTTGGGTGG - Intergenic
992360116 5:76028861-76028883 ATTGCCAAATGTCTCCTGAGGGG + Intergenic
992515683 5:77490395-77490417 ATTGCCAAATGTCTCCTGCGGGG + Intronic
992647063 5:78820825-78820847 ATTGCCAAATCTCCCCTGGGGGG + Intronic
992681386 5:79156860-79156882 CTTGTCAACTGGCTCCTGGTTGG - Intronic
992812559 5:80404185-80404207 ATTGTCAAACGTCCTCTGGGAGG + Intergenic
994263652 5:97688983-97689005 ATTGTCAAATAACCCCTAGGAGG + Intergenic
994672654 5:102781013-102781035 GTTGCCAAATGTCTCCTGGAGGG + Intronic
994678672 5:102858324-102858346 ATTGCCAAATGTCTTCTGAAGGG - Intronic
995139529 5:108719818-108719840 ATTGCCAAATGTCCCCTGGAGGG - Intergenic
995634869 5:114176241-114176263 TTTGCCAAATGTCCCCTGGAGGG + Intergenic
995839082 5:116426242-116426264 ATTTTCAAATGTCCGCTGGGGGG - Intergenic
996304304 5:122029075-122029097 GTTGCCAAATGTTCCCTGGGGGG - Intronic
997031356 5:130132690-130132712 ATTGCTAAGTATCTCCTGGGTGG - Intronic
997561694 5:134851442-134851464 ATTGCCAAATGTTCCCTGGGGGG - Intronic
997816025 5:137018059-137018081 ATTACCAAATGTCCCCTCGGGGG - Intronic
997852389 5:137344503-137344525 ATTGGCAAATGTCCCCTAGGGGG - Intronic
998167248 5:139851338-139851360 AGTGTGAAAAGTGTCCTGGGAGG + Intronic
998394991 5:141812502-141812524 ATTGCCAAATGTCCCTTGGGGGG + Intergenic
998573337 5:143285341-143285363 ATTGCCAAATATCCCCTTGGAGG - Intronic
998654437 5:144160955-144160977 ATTGTCAAATGTCCCCTTGGAGG + Intronic
998855463 5:146390692-146390714 ATTGCCCCATGTCCCCTGGGGGG + Intergenic
999112281 5:149132117-149132139 ATTGCCAAATGTCCCCAGGCAGG - Intergenic
999300494 5:150487052-150487074 ATTCTGAAAGCTCTCCTGGGTGG - Intronic
999433750 5:151545967-151545989 ATGGTCCAATTTCTTCTGGGTGG + Exonic
999508585 5:152224038-152224060 AATGTCAAATGTCCCCTAAGGGG - Intergenic
999519743 5:152338973-152338995 ACTGATAAATGACTCCTGGGTGG + Intergenic
999588390 5:153116847-153116869 GTTTTCAAATGTCTCCTGAGGGG - Intergenic
999821443 5:155232984-155233006 ATTGCCAAATGTCTCTGGGAGGG - Intergenic
999841017 5:155426538-155426560 ATTGTCAAATATTCCCTGGGAGG + Intergenic
1000007064 5:157195981-157196003 TTTGTCAAATGTCCCCTGGTGGG - Intronic
1000161311 5:158600320-158600342 ATTGCCAAATGTCTCCTGAGGGG + Intergenic
1000383134 5:160647020-160647042 ATTGTCAAATGTCTCCTGGTTGG + Intronic
1000461966 5:161534164-161534186 ATTATCAAATGCACCCTGGGGGG - Intronic
1000545055 5:162589195-162589217 ATTTGCCAATGTCACCTGGGTGG + Intergenic
1000957209 5:167557687-167557709 ATTGTCTAATGTCCCCTGGAGGG - Intronic
1001007446 5:168065928-168065950 GTTGTAAAATGTTTCCAGGGTGG - Intronic
1001075524 5:168624788-168624810 ACTGCCAAATGTCTCCTGGGAGG - Intergenic
1001079939 5:168660360-168660382 ACTGCCAGATGTCTCCTGGGTGG + Intergenic
1001157077 5:169281877-169281899 ATTGCCAAATGTCCCCTGGGGGG - Intronic
1001251667 5:170151705-170151727 ATTGCCAAATGTCCCCTGGAGGG - Intergenic
1001606137 5:172961036-172961058 ATTGCCAAATGCTCCCTGGGGGG + Intronic
1001706633 5:173745805-173745827 ATTGCCAAATGTCCCGTAGGAGG + Intergenic
1001804080 5:174568585-174568607 CTTGCCAAATATCTTCTGGGGGG - Intergenic
1001831786 5:174794957-174794979 ATCGACAAATATCTCCTGGGGGG + Intergenic
1002022145 5:176370511-176370533 ATTGTCAAATGTTTCCTAATAGG - Intronic
1002424719 5:179168249-179168271 ACTGCCAAATGTCCCCCGGGTGG + Intronic
1002655682 5:180744791-180744813 ATTGTCAAATGTCCCCTAAGGGG - Intergenic
1002901242 6:1411229-1411251 ATTGCCAAATGTCCCCTGGTGGG - Intergenic
1003235712 6:4293839-4293861 ATTGCTAAATGACCCCTGGGGGG + Intergenic
1003243280 6:4362857-4362879 ATTGCCAAATGTCCCCTGGGGGG - Intergenic
1003501623 6:6707970-6707992 ATTGCCAATTGTCCCCTGAGGGG + Intergenic
1003825366 6:9946024-9946046 ATTGCCAAAGGTCCCCTTGGAGG - Intronic
1003966532 6:11257320-11257342 ATTGGCAAATAACCCCTGGGAGG + Intronic
1004017607 6:11746536-11746558 ATTGCCAAATGTCCCCTGCAGGG + Intronic
1004096319 6:12558312-12558334 ATTTTCAAATGTCCTCTAGGAGG + Intergenic
1004142405 6:13031044-13031066 TTGGCCAAATGTCTCATGGGAGG + Intronic
1004201676 6:13554613-13554635 ATTGCCAAATGTCTTCCAGGAGG - Intergenic
1004429155 6:15528421-15528443 ATTGCCAAATGTCCCCTTGGGGG + Intronic
1004457471 6:15804299-15804321 ATTGACAAATGTGGCCTTGGAGG + Intergenic
1004461861 6:15844241-15844263 ATGTTCAAATGTCGCCTAGGAGG - Intergenic
1004581411 6:16957515-16957537 ATTTCCAAATGTACCCTGGGTGG - Intergenic
1004776114 6:18846874-18846896 ATTGCCAAATATCCTCTGGGAGG + Intergenic
1005108646 6:22253192-22253214 AGTGCCAAATGTCCCATGGGGGG + Intergenic
1005112827 6:22303030-22303052 ATTGCCAAATGTCTCCTGGGAGG - Intergenic
1005546159 6:26874532-26874554 ATTGTCTAATTTCCCCTGGTAGG + Intergenic
1005566861 6:27104912-27104934 ATTGTCAAATGTCTCCTAATGGG - Intergenic
1006213783 6:32420971-32420993 ATTGGCAAATGCCCCATGGGTGG - Intergenic
1006235635 6:32629178-32629200 ATTGTCAAATGTCACTTGAGGGG - Intronic
1006277934 6:33021276-33021298 ATTGGCAAATATCCCCTGTGAGG - Intergenic
1006381269 6:33698781-33698803 ATTGCCACATGTCCCCTGGGGGG + Intronic
1006441754 6:34057627-34057649 ATTGCCAAATATCCCCTTGGGGG + Intronic
1006619939 6:35356724-35356746 ATTGCCAAATGTCTCCTAGGGGG + Intronic
1006655896 6:35592740-35592762 ATTGCCAAAGGTTTCCTGGAGGG - Intronic
1007302926 6:40882022-40882044 ATTGTCAAATGTCCCCCTGGGGG - Intergenic
1007422029 6:41725289-41725311 ATTGGCAAATGTCCCCTAGGGGG + Intronic
1007448888 6:41928074-41928096 ATTGCCAAATGTCCTCTGGGAGG + Intronic
1007541198 6:42646560-42646582 ATTCACAGATGTCCCCTGGGGGG - Intronic
1008008195 6:46434766-46434788 ATTGCCAGATGTCCCCTGGGGGG - Intronic
1008129680 6:47706522-47706544 GTTGTCAAATGTGCCCTTGGAGG - Intronic
1008145239 6:47883814-47883836 ATTGTCAAATGTTGCCTGTGGGG + Intronic
1008152729 6:47974627-47974649 ATTGCTAAATATCCCCTGGGAGG + Intronic
1008700289 6:54091131-54091153 ATTGCCAAAGGTACCCTGGGGGG + Intronic
1009016869 6:57915322-57915344 ATTGTCTAATTTCCCCTGGTAGG + Intergenic
1010231505 6:73539265-73539287 ATTGTCAATTGTCCCAGGGGAGG - Intergenic
1010326564 6:74570342-74570364 ATTTTCAAAAGTGTCCTGGTTGG + Intergenic
1010392764 6:75356035-75356057 ATTGCCAAATGTTCCCTGGAGGG + Intronic
1010649596 6:78436508-78436530 ATTGTCAATTGACCACTGGGTGG + Intergenic
1010754038 6:79646156-79646178 ATTCTCAAATGTCCCCTAGGGGG + Intronic
1010754534 6:79652036-79652058 ATTGCCAAATGTCCCCCAGGAGG + Intronic
1011038855 6:83008238-83008260 ATTGCCAAATGTCTCCTGTGAGG + Intronic
1011056922 6:83215265-83215287 ATTGTCAAGTATCCCCTTGGGGG - Intronic
1011058077 6:83228498-83228520 ATTGCCAAATGTTTCCTGCAGGG + Intronic
1011275359 6:85625880-85625902 AATGTCAAATGACTTCTGGGGGG - Intronic
1011585474 6:88920019-88920041 ATTACAAAATGTCCCCTGGGGGG - Intronic
1011780916 6:90788518-90788540 ATTGCCAAATCTTCCCTGGGAGG + Intergenic
1012135243 6:95548009-95548031 ACTGCCAAATGTCTCCTAGGGGG - Intergenic
1012278804 6:97304128-97304150 ATTGTTAAGTGTCTCCTGGAAGG + Intergenic
1012331197 6:97990059-97990081 ATTGTCAAATCTCCCCTGGAGGG - Intergenic
1012464750 6:99504731-99504753 ACTGTCAAATGTCCCCTAGGTGG - Intronic
1012841156 6:104330712-104330734 ATTGCCAAATGTCCCTTGGAGGG - Intergenic
1012919824 6:105209869-105209891 ATTTCCAAATGTCCCCTGGAGGG - Intergenic
1013143011 6:107358858-107358880 ATTGGCAAATGTCCCCAGGAGGG + Intronic
1013459470 6:110361063-110361085 ATTGCCAAATGTCCCCTGGGAGG - Intergenic
1013515455 6:110881365-110881387 GTTGCCACATGTCTTCTGGGTGG + Intronic
1013609097 6:111777613-111777635 ATTACCAAATGTCCTCTGGGAGG + Intronic
1013642325 6:112097947-112097969 ATTGTCAAATGTCCCCTGGTGGG - Intronic
1014102074 6:117522345-117522367 ATTGCCAAATGTCTCATGGTGGG + Intronic
1014119772 6:117711536-117711558 GTTGTCAAATGTCCACTGGGGGG - Intergenic
1014545160 6:122726759-122726781 ATTGTCAAATGCCCTCTAGGGGG - Intergenic
1014740735 6:125145220-125145242 ATTGCCACATGTCTCCTGGAGGG - Intronic
1014780904 6:125563569-125563591 ATTGCCAAATGTCCCCTGGGAGG + Intergenic
1014818339 6:125958681-125958703 ATTGCAAAATGTACCCTGGGAGG - Intronic
1014950754 6:127552093-127552115 ATTGCCAAATGTCCTCTGGTAGG + Intronic
1015026205 6:128535793-128535815 ATTGCTAAATGTCTCCCAGGGGG - Intergenic
1015639523 6:135316076-135316098 ATTGCTAAATGACTCCTGGATGG + Intronic
1016078577 6:139828196-139828218 ATTGCCAAATGTCCCCTGTGAGG - Intergenic
1016323061 6:142869032-142869054 ATTGCCAAATATCCCCTAGGGGG - Intronic
1016469105 6:144356384-144356406 ATTGCCAGATGTCTCGTAGGTGG + Intronic
1016656521 6:146524608-146524630 ATTGCCAAATATCTCCTGGGGGG - Intergenic
1016696313 6:147000204-147000226 ATTGCCAAATATCTGCTGAGAGG - Intergenic
1017312209 6:152987140-152987162 GTTGTCAGATGTCTCCTGCGGGG + Intergenic
1017775783 6:157679852-157679874 ATTGCCAAATGTCTCAAGAGTGG + Intergenic
1018083857 6:160284319-160284341 ATTGCCAAATGTCCCCTGAGGGG - Intergenic
1018128033 6:160700955-160700977 AATGTGAAATGTCTCTTAGGGGG - Intergenic
1020261524 7:6533063-6533085 ACTGCCAAATATCCCCTGGGTGG - Intronic
1020333761 7:7045400-7045422 ATTGGCAAATATCTTCTTGGGGG - Intergenic
1020400823 7:7775307-7775329 ATAATCATATGTGTCCTGGGAGG + Intronic
1020569307 7:9838338-9838360 ATTGCCAAATGTCCTATGGGAGG + Intergenic
1020754584 7:12185788-12185810 ATTGACAAAAGTCCCCTGGATGG + Intergenic
1021096949 7:16546463-16546485 ATTGTCAAATGCTCCCTGGGGGG + Intronic
1021097846 7:16553582-16553604 ATTGTGAAATGCCCCCTGGGAGG - Intronic
1021470064 7:20991770-20991792 TTTGCCAAATGTCTCCTGGGGGG + Intergenic
1021695936 7:23276525-23276547 ATTGCCAAATGTCCTCTAGGGGG - Intergenic
1021952182 7:25785862-25785884 ATTGCCAAATGTTCCCTGGAGGG - Intergenic
1022109077 7:27216955-27216977 ACTGCCAAATGTCCCCTGGGGGG + Intergenic
1022386265 7:29901947-29901969 ATTGCCAAATGTCTCCTGGGAGG - Intronic
1022481834 7:30749326-30749348 ATTGTCAAATGTCCCCTGGGAGG - Intronic
1022541148 7:31136396-31136418 ATTGTCAAATGGCTCCTTCCAGG - Intergenic
1022614012 7:31910013-31910035 TCTGCCAAATGCCTCCTGGGAGG + Intronic
1022772964 7:33494144-33494166 ATTGTCAAATGTCTCCCTGGGGG - Intronic
1022788537 7:33663539-33663561 ATTGCCAAATATGCCCTGGGGGG - Intergenic
1022861312 7:34369775-34369797 ATTGCCAAACATCTCCTGTGGGG - Intergenic
1023064141 7:36359197-36359219 ATTGCCAAATGTTCCCTGGAGGG - Intronic
1023093058 7:36633981-36634003 ACTGCCAAATGTCCCCAGGGTGG + Intronic
1023093431 7:36637470-36637492 ATTGCCAAATGTCCCCTGGAAGG - Intronic
1023108617 7:36787982-36788004 ATTTCCAAATGTCTCCTGCAGGG + Intergenic
1023164918 7:37334222-37334244 ATTGCCAAATGTCTCTTGGGCGG - Intronic
1023527385 7:41118855-41118877 ATTGGTAAATGTCCCCTGGATGG + Intergenic
1023695131 7:42837681-42837703 ATTGCCAGATGTGTCCTGGGAGG - Intergenic
1023739872 7:43269797-43269819 ATTGCCAATTGTCTCCTCAGAGG - Intronic
1023771240 7:43558504-43558526 ATTGTCAACTGCCTCTTGCGGGG - Intronic
1023861311 7:44219006-44219028 ACTGTCAGCTGTCTCTTGGGAGG - Exonic
1023980893 7:45069341-45069363 ATTGCTACATGTCCCCTGGGAGG + Intronic
1024481401 7:49867084-49867106 ATAGCCAAATGTCTCCCTGGGGG + Intronic
1024924556 7:54599363-54599385 ATTGCCAAAAGTCTCCTGGAGGG - Intergenic
1025218421 7:57081313-57081335 ATTGACAAATGTCCCCTGGGGGG + Intergenic
1025244858 7:57309209-57309231 ATTGCTAAATGTCCACTGGGGGG + Intergenic
1025652927 7:63489148-63489170 ATTGACAAATGTCCCCTGGGGGG - Intergenic
1025921552 7:65917905-65917927 ATTGTCAAATGTTCCCTGGTAGG - Intronic
1026348434 7:69494999-69495021 ATTGCCAAATGTCCCCTAAGGGG + Intergenic
1027772134 7:82419880-82419902 ATCATCAGATGTCTCCTGAGGGG - Intronic
1027794641 7:82677243-82677265 ATTGCCAAATGTCTCTTGCAGGG - Intergenic
1027812600 7:82923975-82923997 ATTGGCAAATGTCTCCTGGAAGG + Intronic
1028224512 7:88234118-88234140 AGTGTCAAATGTCCCTGGGGGGG + Intergenic
1030704266 7:112674941-112674963 ATTATCAAATGTCCCTTGGGGGG - Intergenic
1030933590 7:115556473-115556495 ATTGTCAAATGTCCCCTGGAAGG + Intergenic
1030991704 7:116308973-116308995 GTTGCTAAATGTCTCTTGGGAGG - Intronic
1031007936 7:116495874-116495896 GTTGCCAAATGTCCTCTGGGGGG - Intronic
1031069096 7:117142505-117142527 GTTGCTAAATGTCCCCTGGGGGG + Intronic
1031159859 7:118153272-118153294 ATTGCCAAATGTCCTCTGGGAGG + Intergenic
1031372248 7:120982501-120982523 ATTACCAAATGTCTCCTGTTTGG + Intergenic
1031505690 7:122579217-122579239 ATTGCTAAATGTCTCCTGGAGGG - Intronic
1031632246 7:124057995-124058017 GTTGTCAAATGTTCCCTGGGGGG - Intergenic
1031714279 7:125088075-125088097 ATTGCCAAATATCCCCTAGGAGG + Intergenic
1032354983 7:131202690-131202712 ATTGTCAAATGTCCCCATGGTGG + Intronic
1033512242 7:142070488-142070510 ATTGCCAAATGTCCCCTGGTAGG - Intronic
1033515271 7:142099107-142099129 ATTGCCAAATGTCCCCTGGTAGG - Intronic
1033525206 7:142206429-142206451 ATTGTAAAATGTCTCCAGAGAGG + Intronic
1033783182 7:144697230-144697252 AATGTCAAATGTCCCTTGGTGGG + Intronic
1033903464 7:146172232-146172254 ATTGCCAGATGTTTCCTGGGAGG - Intronic
1034002611 7:147432303-147432325 ATTGCCAAATAGCTCTTGGGAGG + Intronic
1034242333 7:149620178-149620200 TTTGCCAAATGTCCCCGGGGAGG - Intergenic
1034735713 7:153427575-153427597 ATTGTAACATGTGTCCTAGGTGG + Intergenic
1034851572 7:154498858-154498880 ATTCCCAAATGTCCCCTGAGAGG + Intronic
1035149141 7:156852668-156852690 ATTGCAACATGTCTCCTGGGGGG - Intronic
1035746331 8:1964143-1964165 ATTGCCGAATGTCTCCTAGGGGG - Intergenic
1035907388 8:3528030-3528052 ATTGCCATTTGTCCCCTGGGTGG + Intronic
1036123549 8:6043492-6043514 ATTGCCAAGTGCCTCCTGGAAGG - Intergenic
1036805832 8:11832663-11832685 ATTGTCCAATGTCCTCTGGGGGG - Intronic
1036920100 8:12844204-12844226 ATTGCCAAATGTTTTCTAGGGGG + Intergenic
1037393841 8:18421522-18421544 ATAGCCAAATGTCCCCTTGGAGG - Intergenic
1037779624 8:21858868-21858890 ATTGCTGAATGTCCCCTGGGAGG + Intergenic
1038423410 8:27448982-27449004 ATTGTCAAATGTCCTCTCAGAGG - Intronic
1039308539 8:36291071-36291093 ATTGTCAAGTGTCCCTTGGAGGG + Intergenic
1039804045 8:40983655-40983677 AGTGTTAGATTTCTCCTGGGAGG - Intergenic
1040058022 8:43077794-43077816 ATTGCCAAATGTCCCCCGAGCGG + Intronic
1040563982 8:48549583-48549605 ATTGCTAAATGTCTCCTGGGGGG + Intergenic
1041534820 8:58914493-58914515 ATTGACAAATATCTTCTGGAAGG - Intronic
1041629450 8:60069532-60069554 ACTGTCAAATGTCCCTTGGGGGG - Intergenic
1042024766 8:64411425-64411447 ATTACCAAATGTCTTCTGGAGGG - Intergenic
1042429587 8:68689662-68689684 ATTGCCAAATGCCTCTTGGGAGG - Intronic
1042477419 8:69264550-69264572 ATTACCAAATGTCCCCGGGGGGG + Intergenic
1042518444 8:69684235-69684257 GTTGCCAAAGGTCCCCTGGGGGG - Intronic
1042825875 8:72978777-72978799 ATTGTCAAATGTTCTCTAGGGGG - Intergenic
1043210139 8:77503824-77503846 ATTCTCAAAAGTATCCTGGTTGG - Intergenic
1043526339 8:81100561-81100583 ATTGCCAAATGTCCTCTAGGGGG + Intronic
1043795716 8:84535846-84535868 GTTACCAAATGTCTCCTGGGAGG + Intronic
1043881268 8:85546115-85546137 ATTGCCAAAAGTCTTCTGAGGGG - Intergenic
1043928390 8:86063745-86063767 ATTGTTAAATGTCCCCTGTGGGG - Intronic
1044734458 8:95265248-95265270 ATTGCCAAATGCCCCTTGGGTGG + Intronic
1044810762 8:96058909-96058931 GTTGCCAAATGTCCCCTGGGAGG + Intergenic
1044902804 8:96966642-96966664 ATTGCCAGATGTCCCCTGGGGGG + Intronic
1045860873 8:106813924-106813946 ATTGCCAAATGTCCCCTGGGGGG - Intergenic
1045985011 8:108239669-108239691 ATTGCCAAATGTCCCCAGGAAGG + Intronic
1046069277 8:109231165-109231187 ATTGCCAAATGTTCCCTGGGAGG - Intergenic
1046087718 8:109459245-109459267 ATTGCTAAATGTCCCCTGGGAGG + Intronic
1046126884 8:109921016-109921038 ATTTCAAAATGTCCCCTGGGGGG + Intergenic
1046697473 8:117358094-117358116 ATTGTCAAGTGTCTTTTGGAAGG - Intergenic
1047104227 8:121715759-121715781 ATTGCCAAATGTCCCTTGGGTGG - Intergenic
1047139662 8:122123676-122123698 AGTATCAAATGTCCCCTGGTGGG + Intergenic
1047158787 8:122352864-122352886 ATTGTCAAACTTCCTCTGGGTGG + Intergenic
1047179672 8:122575102-122575124 ATTGCCAAATATCTCCTGGAGGG + Intergenic
1047184004 8:122615520-122615542 ACTGCCAAATGTCCCCTGGTGGG + Intergenic
1047449543 8:124952576-124952598 ATTGCCAAATGTTCCCTGGGAGG + Intergenic
1047709096 8:127532512-127532534 ATTTCCAAATGTCCCCTAGGTGG + Intergenic
1047736252 8:127767783-127767805 ATTGCCAAATGTCCCTTGGGAGG + Intergenic
1047797602 8:128273752-128273774 ATTGCCTAATGTCTCCAGGGGGG + Intergenic
1047946443 8:129885664-129885686 ACTGTCAAATGTCCCCTAGGAGG + Intronic
1048069568 8:131007367-131007389 ATTGTCAGATGTCTCCTTGCAGG - Intronic
1048257945 8:132919739-132919761 ATTGCCAAATGTCTCTTGGGTGG + Intronic
1048709908 8:137198084-137198106 ATTGTAAAATGTCACCTCTGTGG - Intergenic
1049096753 8:140552911-140552933 ACTGCCAGATGTCCCCTGGGGGG + Intronic
1049623317 8:143609029-143609051 ACTGCCGAATGTCCCCTGGGTGG - Intronic
1049896927 9:117550-117572 ATTGTCGAACATGTCCTGGGAGG + Exonic
1049941044 9:546246-546268 ATTGCCAAATATTCCCTGGGAGG - Intronic
1050053347 9:1625791-1625813 ATTGGCACAAGTCTCCAGGGAGG - Intergenic
1050122535 9:2322002-2322024 ATTGCCAAATGTCCCTTGAGGGG + Intergenic
1050139827 9:2505863-2505885 GCTGTCAAATGTCCTCTGGGGGG + Intergenic
1050183294 9:2943319-2943341 ATTGCCAAATGTCCCCTTGCAGG - Intergenic
1050413067 9:5386369-5386391 ACTGCCAAATATCCCCTGGGAGG - Intronic
1050778466 9:9299302-9299324 ATTGCCAAATGTCCTCTGGGGGG - Intronic
1051096411 9:13470999-13471021 ATTGCCAAATTTCCCATGGGAGG - Intergenic
1051098638 9:13495739-13495761 ATTGCCAAATGTTTTCTAGGGGG - Intergenic
1051605386 9:18913131-18913153 ATTATAACATTTCTCCTGGGAGG - Intergenic
1051617072 9:19016527-19016549 ATTGCCACATGTTTCCTTGGGGG - Intronic
1052037633 9:23701105-23701127 ATTGCCAAATGTTCCCTGGGAGG + Intronic
1052343755 9:27387945-27387967 ATTGCCAAATGTTGCCTGTGGGG - Intronic
1052739067 9:32376000-32376022 ATTGTCACATGTCCCCTGGGTGG + Intergenic
1053537037 9:38936352-38936374 ATTGCCAAATGTCCCCTGAGGGG + Intergenic
1053902904 9:42812807-42812829 ATTGACAAATGTCCCCTGAGGGG - Intergenic
1054442992 9:65283796-65283818 ATTGTCGAACATGTCCTGGGAGG + Exonic
1054487288 9:65737705-65737727 ATTGTCGAACATGTCCTGGGAGG - Exonic
1054629099 9:67427578-67427600 ATTGCCAAATGTCCCCTGAGGGG - Intergenic
1054916732 9:70501360-70501382 ACTGCCATGTGTCTCCTGGGGGG + Intergenic
1055110739 9:72556879-72556901 ATTGTCAAATGTCCCCTTGGAGG - Intronic
1055317843 9:75052103-75052125 ATTGCCAACTGTCCCCTGGAGGG - Intergenic
1055371188 9:75601462-75601484 ATTGCCAAATGTCCACTGGGAGG + Intergenic
1055460977 9:76519931-76519953 ATTGTGAGATGTCTCTTGGAAGG + Intergenic
1055536392 9:77250394-77250416 ATTGACAAATGTCTCTTGGGGGG - Intronic
1055654419 9:78438901-78438923 ATTTCCAAATGTCTCCGGGGAGG + Intergenic
1055792134 9:79934320-79934342 ATTGCTAAATGTCCCCTGAGGGG + Intergenic
1056117607 9:83456366-83456388 ATTGTGAAATGTATACAGGGAGG - Intronic
1056251226 9:84750233-84750255 ATTGTCAAGTGTCCCCTGGATGG + Intronic
1056596651 9:88013329-88013351 ATTGTGAATTGTCTCCTTAGTGG - Intergenic
1057401797 9:94729764-94729786 GTTGCCAAATGTCTTCTGAGGGG + Intronic
1057563813 9:96150579-96150601 ATTGCCTAATGTCACCTGGGGGG + Intergenic
1057908866 9:99003117-99003139 ATTGTCTAATGCCTTCTGGATGG + Intronic
1057941478 9:99288982-99289004 ATTGTCACATATCTTCTGGGTGG - Intergenic
1058136447 9:101313165-101313187 ATTGCCAAATTCCTTCTGGGTGG + Intronic
1058285460 9:103171378-103171400 ATTGTCAAATATTGCCTGGCAGG - Intergenic
1058458446 9:105159929-105159951 ATTGTCAAATGTGCCCTAGGGGG + Intergenic
1058746639 9:107997944-107997966 GTTGCTAAATGTTTCCTGGGAGG + Intergenic
1058813434 9:108662703-108662725 ATTGTGAAATGTCCCCTGGGAGG + Intergenic
1058820611 9:108725871-108725893 ATTGCCAAATGTCCCCTGGAGGG - Intergenic
1058849611 9:108998152-108998174 ATTGCCAAATGTCCCGTGAGGGG - Intronic
1059440489 9:114304116-114304138 ATTGCCAAATATCCCCTGGGGGG + Intronic
1059748207 9:117223243-117223265 ATTACCAAATGCCTCTTGGGGGG - Intronic
1059771871 9:117434408-117434430 GTTGCTAAATGTCTCCTGGGGGG - Intergenic
1060062573 9:120474343-120474365 ATGGCCAAATGTCCCCTGGCGGG - Intronic
1060623456 9:125088995-125089017 ATTGCCAAATGTGTCTTGGGAGG + Intronic
1060628354 9:125133969-125133991 ATTCTCAAATGTCCCTTAGGAGG + Intronic
1060728014 9:126018643-126018665 ATTACCAAGTGTCCCCTGGGGGG + Intergenic
1060947702 9:127579781-127579803 ATTTCCAAATGTCCCCTAGGAGG - Intergenic
1061026401 9:128052526-128052548 ATTGCCTAATGTCCCCTGGCGGG - Intergenic
1061334882 9:129926429-129926451 ATTGTCACATGTCCTCTGGGAGG - Intronic
1061373749 9:130212310-130212332 ATTGCCAAATATCCCCTCGGGGG - Intronic
1061637744 9:131925077-131925099 CTTGCCAAATGTCTGCTGGGAGG + Intronic
1061683516 9:132256821-132256843 ATTGTCAAATGTCCCCCTGAGGG + Intergenic
1185622253 X:1457372-1457394 ATTGCCAGGTGTCTCCTGGACGG - Intergenic
1185646925 X:1622579-1622601 ATTTAAAAATGTCTCCTGGCTGG - Intronic
1185966333 X:4608055-4608077 ATTGCCAAATGTCCCATGGAGGG - Intergenic
1186002977 X:5034622-5034644 ATTGCCAATTGACTCCTGGGGGG - Intergenic
1186013772 X:5167617-5167639 ATTGTCAAATGTCTCCTGGTAGG + Intergenic
1186095357 X:6095682-6095704 ATTGCCAAGTGGCTCCTGAGGGG - Intronic
1186201792 X:7162680-7162702 GTTGCCAAATGTCTCCTGGTAGG + Intergenic
1186282203 X:8004780-8004802 ATTGTCAAATGTCCCCTTCTGGG + Intergenic
1186290233 X:8089310-8089332 ATTGCCAAATATCTCTAGGGGGG - Intergenic
1186368245 X:8918762-8918784 ATTGCCAAATGTCCCCTGCAGGG - Intergenic
1186380497 X:9053749-9053771 ATTGCCAAATGTCTTCTGGGGGG + Intronic
1186390330 X:9152309-9152331 TTTGCCAAATGTCTCCAGAGGGG - Intronic
1186445878 X:9628353-9628375 ATTGTCCAATGTCCCCTGGGGGG + Intronic
1186450083 X:9664937-9664959 TTTGTCAAATGTCCCCTGGTGGG + Intronic
1186545619 X:10446117-10446139 ATTGCCAAATGTCTCCTGGGGGG + Exonic
1186547578 X:10466636-10466658 ATTGTCAAATGTCCCTTAGGGGG + Intronic
1186584237 X:10854867-10854889 ATTGCCACGTGTCCCCTGGGGGG + Intergenic
1186594785 X:10969083-10969105 ATTGCCAAATGTGCCCTAGGAGG - Intergenic
1186628518 X:11322302-11322324 ATTGGCAAATGTGTCCTGGGGGG + Intronic
1186630562 X:11344278-11344300 ATTGTCAGATGTCCCCTTGCGGG + Intronic
1186635654 X:11401574-11401596 ATTGCCAAATGTCCCTTGGTGGG + Intronic
1186640024 X:11445671-11445693 ATTGCCCAATGTCCTCTGGGAGG - Intronic
1186640571 X:11450871-11450893 ATTATCAAATGTCCCCTGGGTGG + Intronic
1186656449 X:11616741-11616763 ATTGCCAAATGTCCCCTGGGTGG - Intronic
1186692546 X:11994074-11994096 ACTGCCAAATGTCTTCTGGGGGG - Intergenic
1186766703 X:12777945-12777967 ATTGTCACATGTCCCTTGGCAGG + Intergenic
1186796137 X:13048175-13048197 ATTGCCAACTGTCTCCTGGGTGG - Intergenic
1186801025 X:13092531-13092553 ATTGCCAAACATCTCCTGGAGGG - Intergenic
1186810996 X:13188278-13188300 ATTGCCAAGTATCTCCTAGGGGG - Intergenic
1186829496 X:13376540-13376562 ATTGCCAGATGTCCCCTGGAGGG + Intergenic
1186830388 X:13384305-13384327 ATTGCCAAATGTCCCCTGGGGGG + Intergenic
1186844731 X:13519288-13519310 ATTGCCAAATGTCCTCTGTGGGG - Intergenic
1186851821 X:13587910-13587932 ATTGCCAAATGTCCCCTGGAAGG - Intronic
1186862930 X:13690972-13690994 ATTGCCAAATGTCTCCTACGAGG - Intronic
1186873155 X:13792172-13792194 ATTGCCAAATGTCCCCTGAGGGG - Intronic
1186876614 X:13824217-13824239 ACTGCCAAGTGTCTCCTGGAGGG + Intronic
1186900108 X:14045386-14045408 ATTGACAAATGTCTCCTGGTGGG - Intergenic
1186958799 X:14712338-14712360 ATTGCCAAATATCCCCTAGGGGG + Intronic
1186973190 X:14872605-14872627 GTTGCCAAAGGTCCCCTGGGTGG + Intronic
1186976850 X:14917010-14917032 ATTGACAAATGTCCCCTGGGGGG - Intronic
1187045513 X:15644701-15644723 ATTGCCAAATGTCTCCTTGAAGG + Intronic
1187049515 X:15681899-15681921 ATTGCTAAATGTCCTCTGGGAGG + Intergenic
1187054069 X:15725026-15725048 ATTGCCAAATGTTCTCTGGGGGG - Intronic
1187067887 X:15858386-15858408 ACTGACAAGTGTCCCCTGGGAGG - Intergenic
1187147261 X:16648329-16648351 ATTCTCAAATGACTCAGGGGTGG + Intronic
1187174119 X:16880664-16880686 ATTGGCAAATGTCCCCTGGGAGG - Intergenic
1187361476 X:18631910-18631932 ATTGCCAAATGTACCCTTGGGGG - Intronic
1187399482 X:18946988-18947010 ATCGCCAAATGTCTCCTGGGAGG + Intronic
1187418568 X:19114691-19114713 ATTGTCAAATGTCCCCTGGGAGG + Intronic
1187560535 X:20398779-20398801 ATTGTCTAATGTCCCCTGGGGGG + Intergenic
1187677323 X:21729490-21729512 ATTGCCAGATGTCCCCTGGGAGG + Intronic
1187826830 X:23339975-23339997 ATTGCCAGATGTCCCCTGGGTGG - Intronic
1187978692 X:24731564-24731586 ATTGTTAAATGTCCCCTTAGAGG - Intronic
1188425915 X:30046656-30046678 TTTGCCAAATGTCCTCTGGGAGG - Intergenic
1188503799 X:30859163-30859185 ATTGCCAGATGTCTCATGGGAGG - Intronic
1188736444 X:33722406-33722428 ATTTCCAAATGTCTCCTCGTAGG + Intergenic
1188976658 X:36683596-36683618 TTTGGCAAATGTTGCCTGGGAGG + Intergenic
1188999878 X:36932813-36932835 ATTTTCAAATCCCTCCTGAGTGG + Intergenic
1189026165 X:37396954-37396976 ATTGCCAAATGCCCCCTCGGGGG + Intronic
1189139513 X:38587030-38587052 ATTGTCAAATATCCCCTGTGGGG - Intronic
1189795553 X:44642636-44642658 ATTGCCAAATGTTCCCTGAGGGG - Intergenic
1189876465 X:45441402-45441424 ATTGTCAAATGTCCCCTTGGAGG + Intergenic
1190031245 X:46975035-46975057 ATTGCCAAATGTCCCCTGGGGGG + Intronic
1190433605 X:50402036-50402058 ACTGACAAATGTCTCCTGGGGGG + Intronic
1190562552 X:51700056-51700078 ATTGCCAGATGTTCCCTGGGAGG + Intergenic
1192095755 X:68208752-68208774 ATTGCCACATGTCCCCTGGGAGG - Intronic
1192349115 X:70341222-70341244 ATTGTGAAATGTTTTCTGAGTGG + Intronic
1193081990 X:77415299-77415321 ATTGCCAAATGTTCCCTGGGGGG - Intergenic
1193143832 X:78057334-78057356 ATTGTCAAATATCCCTTGGTGGG - Intergenic
1193711791 X:84889501-84889523 ATTGCCAAATGTCTCCTGGGTGG + Intergenic
1193812384 X:86067145-86067167 AGTGCCAAATGTCCACTGGGGGG - Intergenic
1194668268 X:96699411-96699433 ATTACCAAATGTTCCCTGGGAGG - Intronic
1194722646 X:97358282-97358304 CTTGCCAAATGTCCCTTGGGAGG - Intronic
1195363371 X:104106125-104106147 CTTGCCAAATGTCCCCTGGGAGG + Intronic
1195757479 X:108213651-108213673 ATTGCCAAATGTCCCCTGAGTGG + Intronic
1195765980 X:108297530-108297552 ATGGCCAAATGTTCCCTGGGGGG + Intronic
1195888474 X:109667241-109667263 ATTGCCAGATATCCCCTGGGGGG - Intronic
1196055653 X:111352071-111352093 ATTGTCCAATATTTTCTGGGAGG - Intronic
1196433301 X:115651155-115651177 ATAACCAAATGTCTCCTGGGTGG + Intergenic
1197155141 X:123262332-123262354 ATTGCCAAATGTCCTCTGAGGGG - Intronic
1197172943 X:123454657-123454679 GTTGCCAAACGTCTCCTGAGAGG + Intronic
1197199597 X:123736437-123736459 ATTGCTAAATGTCTCCTGGAGGG + Intergenic
1197837418 X:130710421-130710443 ACTGCCAAATGTCCCCTGTGGGG - Intronic
1197884095 X:131200172-131200194 ATTGCCAAATGTCCCCTGGTGGG + Intergenic
1198162124 X:134018288-134018310 GTTGCCAACTGTCCCCTGGGGGG + Intergenic
1198177287 X:134169082-134169104 TTTGTAAAATATCTCTTGGGAGG - Intergenic
1198339376 X:135699265-135699287 ATGGTCCAATGCCTCCTGGCAGG + Intergenic
1198374668 X:136026869-136026891 AGTGCCAAATGTCCCTTGGGCGG - Intronic
1198445990 X:136715007-136715029 ATTGCCAAATGTCACCTGAAAGG + Intronic
1198776244 X:140182482-140182504 ATTTTCAAATGTCTGCTGTGTGG - Intergenic
1199212348 X:145227789-145227811 ACTGCCAAATGTCCCTTGGGAGG - Intergenic
1199504917 X:148551031-148551053 ATTGCCTAATGTCTCTTGGGAGG + Intronic
1199785944 X:151104950-151104972 ATTGCCAAATGTGCCCTGGCAGG - Intergenic
1200754494 Y:6977474-6977496 ATTGTCAAATGTCTCTTGGAGGG + Intronic
1202375170 Y:24228676-24228698 ATTTCCAAATGTCCCATGGGAGG + Intergenic
1202495610 Y:25441444-25441466 ATTTCCAAATGTCCCATGGGAGG - Intergenic