ID: 1140734800

View in Genome Browser
Species Human (GRCh38)
Location 16:77888731-77888753
Sequence TTGTCAAATGTCTCCTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 3, 2: 21, 3: 72, 4: 344}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140734791_1140734800 17 Left 1140734791 16:77888691-77888713 CCGTACCGCCAGCGGTGGCAATA 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1140734800 16:77888731-77888753 TTGTCAAATGTCTCCTGGGTGGG 0: 1
1: 3
2: 21
3: 72
4: 344
1140734793_1140734800 9 Left 1140734793 16:77888699-77888721 CCAGCGGTGGCAATAGAAAATGT 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1140734800 16:77888731-77888753 TTGTCAAATGTCTCCTGGGTGGG 0: 1
1: 3
2: 21
3: 72
4: 344
1140734790_1140734800 18 Left 1140734790 16:77888690-77888712 CCCGTACCGCCAGCGGTGGCAAT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1140734800 16:77888731-77888753 TTGTCAAATGTCTCCTGGGTGGG 0: 1
1: 3
2: 21
3: 72
4: 344
1140734792_1140734800 12 Left 1140734792 16:77888696-77888718 CCGCCAGCGGTGGCAATAGAAAA 0: 1
1: 0
2: 1
3: 79
4: 248
Right 1140734800 16:77888731-77888753 TTGTCAAATGTCTCCTGGGTGGG 0: 1
1: 3
2: 21
3: 72
4: 344
1140734787_1140734800 26 Left 1140734787 16:77888682-77888704 CCTCTACTCCCGTACCGCCAGCG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1140734800 16:77888731-77888753 TTGTCAAATGTCTCCTGGGTGGG 0: 1
1: 3
2: 21
3: 72
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140734800 Original CRISPR TTGTCAAATGTCTCCTGGGT GGG Intronic
900774261 1:4570311-4570333 TTGCCAAGTTTCTCCGGGGTGGG - Intergenic
901346056 1:8543754-8543776 TTGCCAAATGTCTCCTGTGAGGG + Intronic
901920016 1:12529285-12529307 TTGTAAACTGTCTCCTGAGCTGG + Intergenic
902556570 1:17250399-17250421 TTGCCAAATGTGCCCTGGGGTGG + Intronic
902888204 1:19422176-19422198 TTGCCAGATGTCTCCTGGCAGGG - Intronic
903248466 1:22034442-22034464 TTGTCAAATGTCCTGGGGGTGGG + Intergenic
904994201 1:34618242-34618264 TTACCAAATGTCCCCAGGGTAGG - Intergenic
905798413 1:40828436-40828458 TTGCCACATGTCCCCTGAGTGGG + Intronic
906904355 1:49873307-49873329 TTGTCTGATCTCTCCTGGCTAGG - Intronic
906934452 1:50200218-50200240 TTGTCAAATGTTTCTTGGTGAGG - Intronic
907015988 1:51013598-51013620 TTGGCAAATGTCCCCTGGGGTGG - Intergenic
907596082 1:55721235-55721257 TTTTCAAATGTTTCAGGGGTTGG - Intergenic
908148916 1:61279269-61279291 TAATCAAATTTCTCATGGGTAGG - Intronic
909140743 1:71861900-71861922 TTTTTAAATGTCTCCTGGCAGGG - Intronic
909366752 1:74833473-74833495 TTCTCAAGAGTCTCCTGGTTTGG + Intergenic
909849442 1:80441845-80441867 TTGCCAAATGTTTCCTGGAGGGG + Intergenic
910174140 1:84410816-84410838 TTGTTAAATGTGTCTTTGGTAGG + Exonic
910949022 1:92624861-92624883 TTGCCAAATGTCCCCTGGCGGGG - Intronic
911167465 1:94736862-94736884 TTATCAAATGTCCCCTGGAAGGG + Intergenic
911368811 1:96972640-96972662 GTCTTAAATGTCACCTGGGTGGG - Intergenic
913327000 1:117636055-117636077 TTGTCAAATGTCACAGGGTTAGG - Intergenic
915366534 1:155320005-155320027 TTGCCAAATGTCCCCTCGGGAGG - Intronic
915947273 1:160162690-160162712 TTGCCAAATGTCCCCAGGGAAGG + Intronic
916212562 1:162370723-162370745 TTGTCAGATGTCCCCTGGTGAGG - Intronic
916370296 1:164086435-164086457 TTATAAATAGTCTCCTGGGTAGG - Intergenic
916391587 1:164336786-164336808 CTGACAAATGTCTCCAGAGTTGG - Intergenic
916664054 1:166949256-166949278 TTGCCAAATATCTCCTGGAAAGG + Intronic
917301785 1:173582421-173582443 TTTTCCAATGTCTCCTGGGCTGG - Intronic
918766372 1:188489637-188489659 TTGTCAAAAGCCTCCAGGGAGGG - Intergenic
920023987 1:202978502-202978524 TTGCCAAATGTCCCCAGGGGGGG + Intergenic
920858778 1:209687664-209687686 TTCTTAAAAGGCTCCTGGGTGGG - Intronic
921167398 1:212516922-212516944 TTGCCAAATGTCCCCTGGGTGGG - Intergenic
921486074 1:215717015-215717037 TGGGCAAATGTCTTCTGGCTTGG + Intronic
922234196 1:223711164-223711186 TTCCCAAATGTCTCCTGGGGTGG + Intronic
922821093 1:228486588-228486610 TTGTCCGCTGTCTCCTGGCTGGG - Intergenic
923054800 1:230417962-230417984 TTGCCAAATGTCCCCTGGGGGGG - Intronic
924320447 1:242843352-242843374 TTTCCAAATGTCTTCTGAGTGGG + Intergenic
1063102863 10:2965600-2965622 TTGACGAATGTCTCCTGTGATGG - Intergenic
1064469441 10:15620671-15620693 TTGTCAGATCTCTCCAGGGGAGG + Intronic
1064990151 10:21249766-21249788 TTTTAAAATGTTTCCTGGCTGGG + Intergenic
1066587212 10:36949117-36949139 TTGCCAAATGTGCCCTGGGGGGG - Intergenic
1067105933 10:43366423-43366445 TTCTCCAATGTCACCTGGCTTGG + Intergenic
1068975210 10:63001854-63001876 TTGCCAAATGTTCCCTGGGGCGG - Intergenic
1069088025 10:64164508-64164530 TTGACATATGTCTCCTAGATTGG - Intergenic
1069323833 10:67206383-67206405 TTGTGAAGGGTATCCTGGGTTGG + Intronic
1069807819 10:71136948-71136970 TTGTCAAATCAGGCCTGGGTCGG - Intergenic
1069948693 10:72004787-72004809 TTGCTAAGTGTCTCCTGGGGTGG - Intronic
1070158350 10:73850430-73850452 TTGCCAAATGTCCCCTGCGGTGG - Intronic
1071014162 10:80974987-80975009 GTGTCCACTGTCTCCTGGTTGGG + Intergenic
1073261664 10:102195271-102195293 TTGTTAAATGTCTCCGGTTTTGG + Intergenic
1075124466 10:119688582-119688604 TTGCCAAATGTCCCCTGGTGGGG + Intergenic
1076040968 10:127248230-127248252 ATTTCAAATGCCTCCTGGGAAGG + Intronic
1082737387 11:56872048-56872070 TTGTCTAATCTCTCATGGCTAGG - Intergenic
1083032862 11:59610180-59610202 TTGCCAAATGTCCCCTGGGGAGG + Intronic
1083694792 11:64435469-64435491 TTACCAAATGTCCCCTGGGGTGG + Intergenic
1086047072 11:82545683-82545705 TTGTCAACTTTCTCTTGGATGGG + Intergenic
1087130126 11:94661941-94661963 GTATCCAATGTCTCCTAGGTGGG - Intergenic
1087555043 11:99707969-99707991 TTTTGAAATGTGTCCTGGATAGG + Intronic
1089006283 11:115094196-115094218 TTGTAAAAGATTTCCTGGGTAGG + Intergenic
1090441802 11:126730535-126730557 TTGCCAAATGTCCCCTAGGTGGG - Intronic
1090532012 11:127600711-127600733 CTGTCAAATGTGCCCTGGTTTGG - Intergenic
1090898820 11:131006601-131006623 TTGCCAAATGTCCCTGGGGTAGG + Intergenic
1091200462 11:133776409-133776431 TTGTCAGATGTCCCCTGGTGAGG + Intergenic
1091728545 12:2863090-2863112 TTGCCAAATGTCCCCTGGCAGGG - Intronic
1093184869 12:16008314-16008336 TTCTCAAATCTCTCCTGCCTTGG + Intronic
1093233008 12:16571582-16571604 TTATCAAAAATGTCCTGGGTTGG + Intronic
1093295441 12:17384101-17384123 TTGGCATAGGTCTCCTGGGGGGG + Intergenic
1093650197 12:21634399-21634421 TTGCCAAATATCCCCTGGGAAGG - Intergenic
1095172546 12:39052992-39053014 TTGTGAAATGTATCATCGGTTGG - Intergenic
1095688220 12:45059955-45059977 TTGCCAAATGTCCCCTGGGGAGG - Intergenic
1095859535 12:46901032-46901054 TTCTCCAGTCTCTCCTGGGTCGG - Intergenic
1097967064 12:65592607-65592629 TTGTCAAATGTTTTCAGGTTGGG - Intergenic
1098753872 12:74332417-74332439 TTGTCAAAAGTCCCTGGGGTTGG + Intergenic
1099463622 12:82955245-82955267 TTGCCAAATATCCCCTGGGGTGG + Intronic
1099817386 12:87667274-87667296 TTATCAGATATCTCCTGGGTTGG + Intergenic
1100764059 12:97843955-97843977 CTGTTAAATGTCTCCTGGCTGGG + Intergenic
1100845989 12:98658674-98658696 TTGTCAAATGTCACCTGGGGGGG - Intronic
1101099241 12:101375347-101375369 TTGCCAAATGTCACCTGGGGGGG - Intronic
1101317860 12:103645863-103645885 TTGCCAAATGGCTTCTGGGCGGG + Intronic
1101343282 12:103861942-103861964 TTGCCAAAAGTCCCCTAGGTGGG + Intergenic
1101356089 12:103978755-103978777 ATGTCAAATGTCCCTTGGGAGGG - Intronic
1101736411 12:107466508-107466530 TTGTCAAGTGGCTTCTCGGTGGG + Intronic
1102279441 12:111607427-111607449 TTGCCAAATGTCTCCTGAGGGGG - Intergenic
1102706728 12:114887555-114887577 TTGCCAGATGTCCCCTGGGGAGG - Intergenic
1103068138 12:117917134-117917156 TTGCCAAATGTCCCCTGGGAGGG + Intronic
1103563891 12:121805865-121805887 TTGGCAAATGTCACCTGCTTCGG - Exonic
1103991753 12:124804106-124804128 TGCTCAGATGGCTCCTGGGTGGG - Intronic
1104488049 12:129168795-129168817 TTGCCAAATGTCCCCTGGGTGGG + Intronic
1105330570 13:19411883-19411905 TTGTCCACTGTCACCTGGCTGGG + Intergenic
1105918639 13:24940658-24940680 TTGTCCACTGTCACCTGGCTGGG + Intergenic
1106510168 13:30406341-30406363 TTGCCAAATGTCTCCTGGGCGGG + Intergenic
1107077123 13:36334557-36334579 TTGTCAAATGTTCTCTGGGGAGG + Intronic
1107722605 13:43264468-43264490 ATGTTAAATATCTGCTGGGTAGG + Intronic
1108514227 13:51183391-51183413 TTCTAATATGTTTCCTGGGTAGG - Intergenic
1109811303 13:67516261-67516283 CTCTCAAAAGTCTCCTGAGTTGG + Intergenic
1110333820 13:74303011-74303033 TTTTCAAAAGTGTCCTGGCTTGG - Intergenic
1110679028 13:78285714-78285736 TTGTGAAGTGTGTCCTGGGTAGG + Intergenic
1111419319 13:87990376-87990398 TTGTCCAATCTCTCATGGCTAGG - Intergenic
1112432421 13:99361773-99361795 TTGCCAAATATCTCCTGGATTGG + Intronic
1113127419 13:106995314-106995336 TTGCCAAATGTCTCCTGTTGGGG - Intergenic
1113447031 13:110377207-110377229 TTGTCAGATGTTTCTTGGTTAGG + Intronic
1114635721 14:24185732-24185754 TTATCAAAAGTGTCCTGGCTTGG - Intronic
1115015960 14:28614511-28614533 TTCTCCAGTGTTTCCTGGGTAGG - Intergenic
1119164280 14:72479506-72479528 TTGCCAAATGTCCCCTGGGTGGG + Intronic
1119591491 14:75892495-75892517 TTGCCAAATGTCTCCTGGGGGGG - Intronic
1120856108 14:89213773-89213795 TTGTCAAATTTCCTCTGGGGTGG - Intronic
1125097798 15:35874563-35874585 TTGTCACACATTTCCTGGGTTGG + Intergenic
1127006283 15:54573681-54573703 TTGCCATATGTCTCCTGAGGGGG - Intronic
1127479928 15:59369112-59369134 ATTTCAAATGTTTCCTGGGAAGG - Intronic
1127913405 15:63436674-63436696 TTGTGCAATGCCTCCTGGGATGG - Intergenic
1129289113 15:74549778-74549800 CTGCCAAATGTCCCCTGGGAAGG - Intronic
1129312409 15:74721900-74721922 GTGTCAAATGTCCCATGAGTTGG - Intronic
1129362853 15:75035214-75035236 TTATCCAATGTCCCCTGGGAGGG - Intronic
1129623003 15:77166550-77166572 TTGTCAAATGTGCCCCGGGGGGG + Intronic
1129904381 15:79175912-79175934 TGGTCAAATGTCCCCTGGGAGGG - Intergenic
1130003976 15:80076666-80076688 TTGTCTAAGGTCTCCTTGGCTGG + Intronic
1130756531 15:86770322-86770344 TTGCCAAATGTCTCCTGTGCGGG - Intronic
1131390971 15:92048597-92048619 ATGTCACATGTCTGCTGGGGAGG + Intronic
1131712456 15:95070975-95070997 TTGCCAAATGTCTCCAGGGTGGG - Intergenic
1134360327 16:13524966-13524988 TTGCTAAATGTCTCCTGGGTGGG + Intergenic
1134635127 16:15786166-15786188 TTGTCAGATGTTCCCTGGGGTGG - Intronic
1134654751 16:15939731-15939753 TTGCCAAATGTCCCCTGGGAGGG - Intergenic
1134676657 16:16095377-16095399 TTGCCAACTGTCCCCAGGGTGGG - Intronic
1134816660 16:17211400-17211422 TTGTCAGGAGTCTCCTGGGGTGG + Intronic
1134829122 16:17309300-17309322 TTGCCAAATGTCCCTTGGGGAGG + Intronic
1135064118 16:19295081-19295103 TTGTCCAATGTCTCCTGGCAAGG + Intronic
1135187161 16:20324985-20325007 TTGCCAAATGTCTTCTTGGGGGG + Intronic
1135418600 16:22288744-22288766 GACTCAAATGTCTCCTGGTTTGG + Intergenic
1136353684 16:29729345-29729367 TTCCCAAATGTCCTCTGGGTGGG - Intergenic
1137752983 16:50880390-50880412 TTGCCAAATGCCCCCTGGGTCGG + Intergenic
1138006424 16:53341961-53341983 TCACCAAATGTCTCCTGGGCAGG - Intergenic
1138104218 16:54278820-54278842 TTGTCAGATGTCCCCAGGGAGGG + Intergenic
1138911043 16:61399170-61399192 TCGTCATATGTCTCTTGGGGGGG + Intergenic
1139038708 16:62978361-62978383 CTGTCAGATGTCTGCTGGGTGGG + Intergenic
1139770137 16:69267969-69267991 TGCTCAAATGTCTCCTGAGGAGG + Intronic
1140036156 16:71372781-71372803 TTGCCAAATGTCCCCCTGGTGGG + Intronic
1140265894 16:73420392-73420414 TTGCCAGATGTCCCCTGGGCAGG - Intergenic
1140734800 16:77888731-77888753 TTGTCAAATGTCTCCTGGGTGGG + Intronic
1141219391 16:82055088-82055110 TTGTCAAATGTTCCCTGGGGGGG + Intronic
1141742778 16:85905105-85905127 TTGCCAAATATCTCCTGGTGGGG + Intronic
1142522761 17:516747-516769 CTGTTAAATGTCTCCTTGATGGG - Exonic
1143298825 17:5893586-5893608 TTCCCAAATGTCTCTTGGGAGGG - Intronic
1145777251 17:27537938-27537960 TTGACAAATATCTCCTAGATAGG + Intronic
1146450856 17:32972821-32972843 TTGTCAAATCTCTCCAGTTTTGG - Intronic
1146659210 17:34653322-34653344 TTGTCCAATGTCACATGGGATGG - Intergenic
1147352228 17:39858679-39858701 TTTTTAAATATCTCCTGGATTGG + Intronic
1147443828 17:40462942-40462964 TGGTCTAATTTCCCCTGGGTGGG - Intergenic
1147660252 17:42113429-42113451 GTGTGAGAGGTCTCCTGGGTTGG - Exonic
1148250924 17:46079372-46079394 GAGTCAGATGTTTCCTGGGTGGG - Intronic
1148601569 17:48898383-48898405 TTGACAAATGCCCCCTGGCTGGG + Intergenic
1148979732 17:51562176-51562198 TTGCCAAATATTCCCTGGGTGGG - Intergenic
1149346504 17:55742118-55742140 TTGTCCAAGGTCTCATGGGCAGG - Intergenic
1150161128 17:62899022-62899044 TTGCCAACTGTGTCCAGGGTTGG + Intergenic
1150383677 17:64740604-64740626 TTGTCAAATGTCATCTTGGGGGG + Intergenic
1150966876 17:69980719-69980741 TTGTCAAATGGCCCCTGGGGGGG + Intergenic
1151099830 17:71544218-71544240 TTGCCAAATGTCCCCTGAGAGGG + Intergenic
1151227991 17:72660888-72660910 TGGCCAAATGTCTCCGGGGAGGG + Intronic
1151713399 17:75819281-75819303 TTGACAAATGTCCACTGGGTGGG - Intronic
1152079362 17:78176889-78176911 TTGTGAGATGTCCCCTGGGTGGG + Intronic
1152106129 17:78330069-78330091 TTGTCTACTGTCTCATCGGTAGG + Intergenic
1153972673 18:10240615-10240637 CTGACAAATGTCGCCTGGGTAGG + Intergenic
1154088306 18:11329289-11329311 TTGTTAAATTTCTCCTCAGTTGG - Intergenic
1155128869 18:22909948-22909970 TTGCCAAATGTCCCCTGTGGGGG + Intronic
1155319822 18:24608279-24608301 CTCTCAAATCTCTCCTGGGGAGG + Intergenic
1155407506 18:25505376-25505398 TTGACCAATGTCTCCTTGGGAGG - Intergenic
1155469596 18:26177200-26177222 TTGTCAAATGTCTTTTAGGTGGG - Intronic
1156039943 18:32809423-32809445 GTTTCTAATCTCTCCTGGGTTGG - Intergenic
1157130608 18:45003932-45003954 TTGCCAAAAGTCTCCTGGTGGGG - Intronic
1157142147 18:45120397-45120419 TTCTCAAAAGTATCCTGGGAAGG + Intergenic
1157597750 18:48874252-48874274 ATTTCAAAGCTCTCCTGGGTGGG - Intergenic
1157996779 18:52566855-52566877 TTGTCAAATGTATCCAAGCTAGG - Intronic
1158168427 18:54569121-54569143 ATGCCAAATGCCTCCCGGGTGGG + Intergenic
1158424217 18:57324509-57324531 TTGTCAAATGTACCTCGGGTCGG - Intergenic
1158728236 18:59994472-59994494 ATGTCAAATGCCACCTGGGAGGG + Intergenic
1159122389 18:64185852-64185874 TTGTCCCCTCTCTCCTGGGTGGG + Intergenic
1160101447 18:75923311-75923333 TTGCCAAATGTCCCCTGGGGTGG + Intergenic
1161908576 19:7175858-7175880 TTGCCAAAAGTCCCCTGGGGAGG + Intronic
1163349197 19:16764757-16764779 TTGTCAAGTGTCCCCTGGGGGGG - Intronic
1164219982 19:23184634-23184656 TAGTCTGAGGTCTCCTGGGTTGG + Intergenic
1166792499 19:45406236-45406258 GTGTTAAATGTCTTCTGGGGAGG - Exonic
1167254024 19:48416344-48416366 TGATGAAATGTCTTCTGGGTAGG - Intronic
1167709489 19:51101408-51101430 TTGCCAAATGTCTCTGGGGGAGG - Intronic
1168214811 19:54917668-54917690 TTGCCAAATGTCCCCTGGAGTGG - Intergenic
1168605207 19:57753355-57753377 CTGTCCAATGTGTCCTGAGTGGG - Exonic
926475095 2:13311914-13311936 TTTTTAAATGGCTCCTGGATTGG + Intergenic
927815151 2:26209186-26209208 TTGTCAAATGTCCCCCTGGGAGG + Intronic
928051161 2:27996752-27996774 TTTGCAAATGTCCCCAGGGTAGG + Intronic
929535625 2:42782471-42782493 TTGTCTGATGTCTCATGGCTAGG - Intronic
930302773 2:49638171-49638193 CTGTCATCTGTTTCCTGGGTAGG - Intergenic
930625484 2:53692140-53692162 TTGCCAAATGTCTACAGGGGGGG + Intronic
930837327 2:55808156-55808178 TTGCCAAGTGTCCCCTGGGTAGG + Intergenic
930907890 2:56594932-56594954 TTGCCAAATGTCCCCTGGGAGGG + Intergenic
931220059 2:60281292-60281314 TTGTAGAATGTCTCCTGATTTGG - Intergenic
931906463 2:66848795-66848817 TTACCAAATGTTCCCTGGGTGGG - Intergenic
931980159 2:67685871-67685893 TGGTCAAATATATCCTAGGTTGG + Intergenic
932218233 2:69980655-69980677 TTGGCAAATGTACCCTGGTTAGG + Intergenic
932428858 2:71661332-71661354 TTGACAAATGTCCCATGGTTAGG - Intronic
934799934 2:97144631-97144653 TTGTCACTTGTATCCTGAGTGGG - Exonic
935191671 2:100782938-100782960 TTCTCAAAATTATCCTGGGTGGG + Intergenic
935760196 2:106313257-106313279 TTGCCAAATATCCCCTGGGGAGG - Intergenic
939561888 2:143742242-143742264 ATGTCAAATGGCTCCATGGTTGG + Intronic
941880749 2:170477761-170477783 TTGTCAAATGTCTCCTGAGGGGG + Intronic
942146511 2:173032316-173032338 TTACCAAATGCCTCCTGGATTGG + Intronic
942274275 2:174307801-174307823 TTGCCAAATGTCACCAGGGATGG + Intergenic
942369208 2:175263657-175263679 ATGTCAAATGTCTTATGGTTGGG + Intergenic
943646648 2:190413437-190413459 TTGCCAAATGTTTCCTGAATTGG - Intronic
943664831 2:190598172-190598194 TTGCCAAATGTTTCCTGGGGAGG + Intergenic
944612104 2:201421548-201421570 TTGTCAGATGTCCCCTGGGGTGG + Intronic
945121188 2:206458906-206458928 CTGTTAAATTTCTTCTGGGTTGG - Intronic
946704486 2:222444996-222445018 CAGTTAACTGTCTCCTGGGTCGG - Intronic
946854527 2:223939848-223939870 TTACCAAATGTTCCCTGGGTGGG + Intronic
947340536 2:229134074-229134096 TTGCCAGATGTCCCCTGCGTGGG + Intronic
947711752 2:232320458-232320480 TTGTCACCTGTCACCTGTGTTGG + Intronic
948471935 2:238187959-238187981 CTGACAAATGTCCCCTGGGCGGG + Intronic
948678145 2:239611194-239611216 GTGTCAAATGTTTCATGGATAGG + Intergenic
948688755 2:239688861-239688883 GTGTCAGAGTTCTCCTGGGTGGG + Intergenic
948844433 2:240676434-240676456 TTGACAAATGGCTTCTGGGGAGG + Exonic
948849427 2:240698445-240698467 TTGACAAATGGCTTCTGGGGAGG - Exonic
1169159288 20:3362697-3362719 TTGTCAAATGTCTAGGGGGAAGG + Intronic
1172041635 20:32050797-32050819 TTGTAAAATGTCCCCTGGTGGGG - Intergenic
1172962972 20:38811677-38811699 TTGCCAAATATCCCCTGGGGAGG - Intronic
1173062147 20:39672779-39672801 TTACCAAATGTCTCCTGGAGTGG - Intergenic
1173447724 20:43135024-43135046 ATATCAAATGTCCCCTGGGGAGG + Intronic
1174612578 20:51810337-51810359 TTGCCAAATGTCCCCTGGTGGGG - Intergenic
1174776467 20:53347315-53347337 TTGCCAGATGTGTCCTGGGGAGG + Intronic
1174957597 20:55117031-55117053 TTGTCAAATGTCTCATGAATAGG - Intergenic
1174983233 20:55421012-55421034 ATGTCTGATGTGTCCTGGGTGGG - Intergenic
1175104000 20:56601076-56601098 TTGTTACCTGTCTCCTGGATGGG + Intergenic
1175305503 20:57973201-57973223 TTGTCAAATGCCCCCTGTGGGGG + Intergenic
1175413428 20:58786121-58786143 TTGCCAAATGTCCCCGGGGGGGG - Intergenic
1175586761 20:60147313-60147335 TAGTTAAATCTCTCCTGGGTAGG + Intergenic
1175613307 20:60370384-60370406 TTGCCAAATGTCTCCTGGTTGGG - Intergenic
1175657172 20:60780987-60781009 TCACCAAATGTCCCCTGGGTGGG + Intergenic
1176250261 20:64117238-64117260 TTCTCATATGTCCCCCGGGTAGG - Intergenic
1177270478 21:18841994-18842016 TTGTCTCATGTCTTCTAGGTTGG - Intergenic
1177749417 21:25261990-25262012 TTGCCAAATATTTCCTGGGATGG + Intergenic
1178053319 21:28771391-28771413 TTACCAAATGTCTCCTGGTCAGG - Intergenic
1178189007 21:30258558-30258580 TTGCCAAATGTGTCCTAGGTGGG - Intergenic
1178248315 21:30975549-30975571 TTGCCAAATGTCCCCTGGAAGGG + Intergenic
1178531210 21:33377791-33377813 TCTTCAAAGGGCTCCTGGGTGGG - Intergenic
1178763282 21:35424777-35424799 TGGTAAAATGTTTTCTGGGTCGG + Intronic
1179099419 21:38343707-38343729 TGGTCAAATGTTTACTTGGTTGG + Intergenic
1180706661 22:17814683-17814705 ATGTCATCTGTCTCCTAGGTTGG + Intronic
1181103831 22:20559983-20560005 TTGTCAAATATCCCCTGTGGTGG - Intronic
1182340612 22:29617519-29617541 TTGTCAAGTGTCCCTGGGGTAGG + Intronic
1182614086 22:31574546-31574568 TAAACAAATGTCTCCTGGATAGG - Intronic
1182792078 22:32961209-32961231 TTGCCAAATGTCTCCTGTTGGGG + Intronic
1182880122 22:33725892-33725914 TTGCCAAATGTCTCCGCGGCAGG - Intronic
1182958191 22:34447007-34447029 TTTCCAAATGTCTCCTAGGAGGG + Intergenic
1184365232 22:44046937-44046959 TTGAGAACTGGCTCCTGGGTCGG + Intronic
1185021918 22:48381548-48381570 GGGTCGATTGTCTCCTGGGTTGG - Intergenic
1185021939 22:48381644-48381666 GGGTCGATTGTCTCCTGGGTTGG - Intergenic
1185021960 22:48381740-48381762 GGGTCGATTGTCTCCTGGGTTGG - Intergenic
949176516 3:1069608-1069630 TTGCCAGATGTCCCCTGGGGAGG - Intergenic
950275088 3:11653969-11653991 TTGCCAGATGTCTCCTGAGGAGG - Intronic
950924716 3:16729043-16729065 TTGCCAAATGTCCCCTGGGGAGG + Intergenic
954875069 3:53797346-53797368 TTTTCACATGTGTTCTGGGTAGG - Intronic
955267442 3:57460118-57460140 TTGTCAAATGTTCCCTGGGGTGG - Intronic
955340491 3:58121630-58121652 CTGTGAAAGGTCCCCTGGGTAGG + Intronic
955419197 3:58719986-58720008 TGGTTAAATGTCTCCTTGGAGGG + Intronic
955650003 3:61183911-61183933 TTCTCAAATGTATCCTGGGTTGG + Intronic
955956255 3:64293096-64293118 TTGCCAAATGTCCCCGGTGTGGG + Intronic
956349494 3:68319351-68319373 TTGTCAAATGTCCCTGGGGTGGG - Intronic
956587291 3:70878260-70878282 TTGCCAAATGTCTCCTGGGTGGG + Intergenic
956620462 3:71216836-71216858 TTGCCAAATGTCCCCTGGTGGGG - Intronic
957270824 3:78028226-78028248 TTACCAAATGTCTCTTGAGTAGG - Intergenic
958045113 3:88274978-88275000 TTTTCAAATGTCTCCCAGGGAGG - Intergenic
960440130 3:117676631-117676653 TCTTCAAATGTCTGCTGGGATGG - Intergenic
960603745 3:119483828-119483850 TGGCCAAATGTCCCCTGGGTGGG + Intronic
961661549 3:128471240-128471262 TTGCCAAATGTCCCCTGGGGAGG - Intergenic
962167196 3:133061795-133061817 TTATAAAATTTCTCCTTGGTGGG - Intronic
963574487 3:147042813-147042835 TTGCCAAATGTGCCCTGGGCTGG + Intergenic
964116660 3:153142861-153142883 GTGACAAATGTTTCCTGGGAAGG + Intergenic
964419529 3:156486644-156486666 GTTACAAATGTCTCCTGTGTGGG + Intronic
969136974 4:5037228-5037250 TTGCCAAATGTTTCCTGGGTGGG + Intergenic
969855071 4:9992479-9992501 TTGTCAAATGTCCCCTGATGAGG + Intronic
970513626 4:16805478-16805500 GTGTCCAGTGTCTCCTGGGGAGG + Intronic
971137241 4:23882569-23882591 TTGTCAAATGTCCCGTGAATTGG + Intronic
971363145 4:25955018-25955040 TTGTCCAATGTCTCCTAGGAGGG + Intergenic
972951673 4:44332917-44332939 TTGTCAAATGTCTCCTCAAAGGG + Intronic
973176613 4:47213746-47213768 TTGTAAAATGTCTTCTGTTTTGG + Intronic
973944472 4:55943026-55943048 TAGTCAGATGCTTCCTGGGTTGG + Intergenic
975672808 4:76798674-76798696 CTGTCAAATGTATCCTGGTTTGG + Intergenic
977415721 4:96730481-96730503 TTGTCAAACGTCTTCTGGTCGGG - Intergenic
977627328 4:99201493-99201515 TTCTCTAATCTCTCCTAGGTAGG + Intergenic
977925170 4:102692454-102692476 TTGTATAATGTCTCCGGGTTTGG + Intronic
978218755 4:106243170-106243192 TTTTCAAATATCTCTTGAGTTGG + Intronic
978551134 4:109928537-109928559 TAGTTAATTCTCTCCTGGGTCGG + Intronic
979112212 4:116774249-116774271 TTGCCAAATGACCCCTGGGCAGG + Intergenic
979210136 4:118090755-118090777 TTTTCAAATGTCTCATGAGCTGG + Intronic
981267316 4:142802135-142802157 GTGTGAAATGTCTTCTGGGTAGG - Intronic
983551749 4:169025005-169025027 TTGCCAAATGTCTCCTAGAAGGG + Intergenic
985143175 4:186863865-186863887 TTGTCATAGGTGTCCTGAGTTGG + Intergenic
986736502 5:10672103-10672125 GTGTCAAATGTTCCCTGGGGGGG + Intergenic
987140240 5:14938486-14938508 TTCTCAAAAGTTTCCTGGTTTGG - Intergenic
987529102 5:19094039-19094061 TTGTCAAGTGTCTCATGTGGTGG - Intergenic
988032452 5:25781285-25781307 TTGCCAAATATCCCCTGGGGTGG - Intergenic
988693024 5:33591760-33591782 TTCCCAAATGTCCCCTGGGGAGG - Intronic
988779153 5:34503329-34503351 TCGGTAAATGTGTCCTGGGTTGG - Intergenic
988844781 5:35116921-35116943 TTGCCAAATGTCTTCCAGGTGGG - Intronic
988945358 5:36191201-36191223 TTACCAAGTATCTCCTGGGTGGG - Intergenic
989620171 5:43376304-43376326 TTGCCAAATGTCCCCTGGGGAGG - Intergenic
990105686 5:52256723-52256745 TTGTCAAAAGTGTCCTAGTTTGG + Intergenic
990249931 5:53903337-53903359 TTATCAAATGTCCCGTGGGAAGG - Intronic
990596432 5:57316785-57316807 TTGCCAAATGTCCTCTGGGGAGG - Intergenic
990726988 5:58766854-58766876 CTGCCAGATGTCTCCTGGCTGGG - Intronic
991976686 5:72190083-72190105 TGGTCAAATGACTCCTGAATAGG - Intronic
992681385 5:79156859-79156881 TTGTCAACTGGCTCCTGGTTGGG - Intronic
992766828 5:80008799-80008821 TTGTCAGATGTCTGGTGGGGAGG + Intronic
993037948 5:82777959-82777981 TTTTCAAATGACTCCTCTGTTGG - Intergenic
996336865 5:122393556-122393578 TTGTTAAATGTTTCTGGGGTAGG - Intronic
996638577 5:125725579-125725601 TTTTAAAATGTCTGCTGGGATGG - Intergenic
997031355 5:130132689-130132711 TTGCTAAGTATCTCCTGGGTGGG - Intronic
999300493 5:150487051-150487073 TTCTGAAAGCTCTCCTGGGTGGG - Intronic
1001007445 5:168065927-168065949 TTGTAAAATGTTTCCAGGGTGGG - Intronic
1001079940 5:168660361-168660383 CTGCCAGATGTCTCCTGGGTGGG + Intergenic
1001157076 5:169281876-169281898 TTGCCAAATGTCCCCTGGGGGGG - Intronic
1001441913 5:171750001-171750023 TTGCCAAATGTCTCCTGGGTTGG - Intergenic
1001702628 5:173718324-173718346 TTGCCAAGTGTCCCCTGGGGAGG - Intergenic
1002218090 5:177654312-177654334 TTGCCAAATAGCCCCTGGGTAGG - Intergenic
1002424720 5:179168250-179168272 CTGCCAAATGTCCCCCGGGTGGG + Intronic
1005566860 6:27104911-27104933 TTGTCAAATGTCTCCTAATGGGG - Intergenic
1007917849 6:45577535-45577557 TTCTCAAAAGTGTCCTGGGTTGG + Intronic
1007993261 6:46279525-46279547 CTCTCAAATGTCTCCTGGGAAGG + Intronic
1008303456 6:49871451-49871473 TTTTCAAATGTATGGTGGGTTGG - Intronic
1008418973 6:51274514-51274536 TTGACAAATGTTTCTTGGGGTGG - Intergenic
1008434110 6:51455056-51455078 TTGTCAAATGTCCCCTGGGGTGG - Intergenic
1008810402 6:55490451-55490473 TTGTCAAGTGTTTCCTGAGTCGG - Intronic
1009547566 6:65040674-65040696 TTGCCAAATGTCTCCTGGAAAGG + Intronic
1010096947 6:72057807-72057829 TTGTCAAAAGTGTACTGGTTTGG - Intronic
1010265952 6:73867469-73867491 TTGTCAAATGTACTCTGGGGAGG - Intergenic
1010326565 6:74570343-74570365 TTTTCAAAAGTGTCCTGGTTGGG + Intergenic
1010401966 6:75456141-75456163 TTGTCAAATGTTCCCTGGGGAGG - Intronic
1010952338 6:82051711-82051733 TTTTCAAATGTTTCCTGTGTTGG + Intergenic
1011920386 6:92568118-92568140 TTGTCAAATGTCACCTTTGCAGG + Intergenic
1013062787 6:106653433-106653455 TTGTCAAGTGTCTCCTGGTTAGG + Intronic
1013576800 6:111491523-111491545 TTGCCAAATGTCCCCTAGGGCGG - Intergenic
1015805192 6:137101640-137101662 TGGTCAGATGCCTCCTGGGTTGG - Intergenic
1016790679 6:148064411-148064433 TTGGCAAATGTGCCCTGGGATGG - Intergenic
1017143956 6:151217042-151217064 TTGTCATATTTGTCATGGGTTGG - Intergenic
1017312210 6:152987141-152987163 TTGTCAGATGTCTCCTGCGGGGG + Intergenic
1017404401 6:154102684-154102706 TTGCCAAATGTCTCCTGGAGTGG + Intronic
1018772897 6:166987563-166987585 TTGTCAGATGTCCCCGGGGGAGG + Intergenic
1019933640 7:4240333-4240355 TTCTGCAATGTCTCCTGGGCAGG - Intronic
1020252151 7:6478018-6478040 TTGTCAAATTTCTCCTAGAAAGG + Intronic
1020754585 7:12185789-12185811 TTGACAAAAGTCCCCTGGATGGG + Intergenic
1020929482 7:14374879-14374901 TTGCCGAATGTCTCCTGAGGAGG + Intronic
1021725569 7:23545010-23545032 TTGCCAAATGTCCTCTGGGGAGG - Intergenic
1023090338 7:36611551-36611573 TCTTAAAATGTCTACTGGGTGGG + Intronic
1023093059 7:36633982-36634004 CTGCCAAATGTCCCCAGGGTGGG + Intronic
1023705942 7:42941903-42941925 TTGCCAAATGTCCTCTGGGGTGG - Intronic
1023915433 7:44585141-44585163 TTGCCAAATTTCCCCTTGGTAGG - Intergenic
1024027506 7:45425242-45425264 TTGCCAAATGTCTCCTGGGGTGG + Intergenic
1024265329 7:47601948-47601970 TTGTCAAATGTGTGCTGAGCAGG - Intergenic
1028551288 7:92069442-92069464 TTGTAAAATGTCACCTTTGTTGG + Intronic
1029197362 7:98814907-98814929 TTGACAAATTTGTCCTGAGTTGG - Intergenic
1031115311 7:117661280-117661302 TTGCAAAATGTCCCCTGTGTTGG + Intronic
1031372249 7:120982502-120982524 TTACCAAATGTCTCCTGTTTGGG + Intergenic
1032842184 7:135723090-135723112 TTGCCAAATGTCCCTTGGGGAGG + Intronic
1035149140 7:156852667-156852689 TTGCAACATGTCTCCTGGGGGGG - Intronic
1035775548 8:2184955-2184977 TTGTCAAATGCTGGCTGGGTGGG - Intergenic
1036073636 8:5470315-5470337 TGGTGAAATGTCTGCTGGTTTGG + Intergenic
1038534595 8:28344739-28344761 TTGTGAAGTGTCTCTTGGGGCGG - Intergenic
1038892669 8:31744261-31744283 TAGTCCAATGTCTATTGGGTAGG + Intronic
1039917137 8:41868369-41868391 TTGCCAAATGTCCCCTGGGGCGG + Intronic
1040561196 8:48524563-48524585 TTTTCCCATTTCTCCTGGGTCGG + Intergenic
1041520474 8:58750344-58750366 TAATCAAAAGTCTCATGGGTGGG + Intergenic
1042473763 8:69221403-69221425 TTTTAAAATTTCTCCTGGGAAGG - Intergenic
1042518443 8:69684234-69684256 TTGCCAAAGGTCCCCTGGGGGGG - Intronic
1043412671 8:80014824-80014846 TTGCCAAATGTCCCCTGGAGTGG - Intronic
1043579298 8:81693254-81693276 TTGTCAAATGTCTGCTATCTGGG + Intergenic
1043592445 8:81846629-81846651 TGGTCAGAAGCCTCCTGGGTTGG - Intergenic
1045402791 8:101835356-101835378 TTGCCAGATATCTCCTGGTTTGG - Intronic
1045407569 8:101882003-101882025 TTGCCAAATGTCTCCTGGGAAGG - Intronic
1046137733 8:110051674-110051696 TTCTCAAAAGTGTCCTGGTTTGG + Intergenic
1047179673 8:122575103-122575125 TTGCCAAATATCTCCTGGAGGGG + Intergenic
1047376136 8:124298995-124299017 TTGCCAAAGGTCCCCTGGGGAGG + Intergenic
1047468184 8:125140298-125140320 TTGTTAAGAGTCTCCTGTGTTGG + Intronic
1047709097 8:127532513-127532535 TTTCCAAATGTCCCCTAGGTGGG + Intergenic
1048582646 8:135742966-135742988 TTGCCAAATGTCCCCTAGGCAGG + Intergenic
1048610944 8:136022504-136022526 TTGCCAAATGTCTTCTGAGCAGG - Intergenic
1048709907 8:137198083-137198105 TTGTAAAATGTCACCTCTGTGGG - Intergenic
1049410401 8:142471433-142471455 TTGTCCAAGGTCTCCGGGATGGG + Intronic
1049623316 8:143609028-143609050 CTGCCGAATGTCCCCTGGGTGGG - Intronic
1050183636 9:2947461-2947483 TTGTCAAATGTCCCTGGGGAAGG + Intergenic
1050222297 9:3406260-3406282 TGTTCAAATGTCCCCAGGGTTGG - Intronic
1051526156 9:18047297-18047319 TTGCCAAATGTTCCCTGGGGTGG - Intergenic
1052739068 9:32376001-32376023 TTGTCACATGTCCCCTGGGTGGG + Intergenic
1053433582 9:38059997-38060019 TTGTAAAATGTCCCCTCTGTTGG - Intronic
1055536391 9:77250393-77250415 TTGACAAATGTCTCTTGGGGGGG - Intronic
1055648400 9:78382637-78382659 TTGCCAAATGTCCCTTGGGAAGG - Intergenic
1055659317 9:78486529-78486551 TTTTCAAAAGTGTCCTGGTTTGG - Intergenic
1057563814 9:96150580-96150602 TTGCCTAATGTCACCTGGGGGGG + Intergenic
1057767551 9:97935352-97935374 TTGTCAAAAGTCTTCTGGGGTGG - Intronic
1057908867 9:99003118-99003140 TTGTCTAATGCCTTCTGGATGGG + Intronic
1059017247 9:110532843-110532865 TTGCCGAATGTCCCCTGGGGAGG + Intronic
1059771870 9:117434407-117434429 TTGCTAAATGTCTCCTGGGGGGG - Intergenic
1060168541 9:121441331-121441353 TTGCCAAATGTCCCGTGGGATGG + Intergenic
1060438487 9:123616750-123616772 TTTTCAAAAGGCTCCTGGGGAGG + Intronic
1060630103 9:125149441-125149463 TTCTCAAATGAGTCCAGGGTGGG + Exonic
1060992218 9:127855738-127855760 TTGTCCAAGGTCTCATGGCTAGG - Intergenic
1061334881 9:129926428-129926450 TTGTCACATGTCCTCTGGGAGGG - Intronic
1061534078 9:131236759-131236781 TTTTCAGATGCCCCCTGGGTGGG - Intergenic
1062148397 9:135004130-135004152 TTGCCAAATGTCTCCTGGGGCGG - Intergenic
1185646924 X:1622578-1622600 TTTAAAAATGTCTCCTGGCTGGG - Intronic
1186013773 X:5167618-5167640 TTGTCAAATGTCTCCTGGTAGGG + Intergenic
1186227634 X:7418594-7418616 TTGCCAAATGTCCCCTTGGCAGG - Intergenic
1186260889 X:7778069-7778091 TTGTCAAATGTCTCCTGTTGAGG + Intergenic
1186295059 X:8140442-8140464 TTGCCAAATGCCTTCTGGGGAGG - Intergenic
1186411649 X:9349225-9349247 TTGCCAAATGTCCCCTGGGATGG + Intergenic
1186523755 X:10228892-10228914 ATGCCAAATGTCTCCTGTGGAGG - Intronic
1186595089 X:10972517-10972539 TTGCCAGAAGTCTCCTGGGGTGG + Intergenic
1186628147 X:11317364-11317386 TTGCCAGATGTCTCCTGGGGTGG + Intronic
1186692545 X:11994073-11994095 CTGCCAAATGTCTTCTGGGGGGG - Intergenic
1186796136 X:13048174-13048196 TTGCCAACTGTCTCCTGGGTGGG - Intergenic
1186898842 X:14032088-14032110 TTGCCAAATGTCTCCTGGGCTGG + Intergenic
1186958136 X:14705323-14705345 TTGCCAAATGTCCCCTGGGGTGG - Intronic
1187005249 X:15226470-15226492 TTGTCAAATGTCCCCTAGGAAGG + Intergenic
1187399483 X:18946989-18947011 TCGCCAAATGTCTCCTGGGAGGG + Intronic
1187826829 X:23339974-23339996 TTGCCAGATGTCCCCTGGGTGGG - Intronic
1188000303 X:24974199-24974221 TTGTCAAATGTTCCCTCGGGTGG - Intronic
1189108254 X:38258870-38258892 TTGTCAAACGTCCGCTGGGGTGG + Intronic
1190031246 X:46975036-46975058 TTGCCAAATGTCCCCTGGGGGGG + Intronic
1190765924 X:53475636-53475658 TAGTCCAATGTCCCCTTGGTAGG - Intergenic
1190867018 X:54393261-54393283 TAGTTAATTGTCTCCTGGATAGG - Intergenic
1192334352 X:70204987-70205009 TTGTCTACTGTCTTCTGGTTTGG - Exonic
1193081989 X:77415298-77415320 TTGCCAAATGTTCCCTGGGGGGG - Intergenic
1193319504 X:80105153-80105175 TTGTCTAATATCTCATGGCTAGG - Intergenic
1193711792 X:84889502-84889524 TTGCCAAATGTCTCCTGGGTGGG + Intergenic
1193943043 X:87700017-87700039 TTGCCAAATGTCCGCTGAGTAGG - Intergenic
1196826785 X:119747048-119747070 TTTTTAAAAGTCTCCTGGCTGGG - Intergenic
1197810017 X:130432977-130432999 TTTTTAAATCTCTCTTGGGTGGG - Intergenic
1197884096 X:131200173-131200195 TTGCCAAATGTCCCCTGGTGGGG + Intergenic
1198331825 X:135629398-135629420 CTGTCAGGTGTTTCCTGGGTTGG + Intergenic
1198339579 X:135700812-135700834 TTGTCAGATGTTTCCTTGGTAGG - Intergenic
1199504918 X:148551032-148551054 TTGCCTAATGTCTCTTGGGAGGG + Intronic
1199660719 X:150047630-150047652 TTGTAAAATGTCTCATCGATAGG + Intergenic
1199722695 X:150553551-150553573 CTTTCAAAGGTCTCCTGGTTTGG + Intergenic
1200754495 Y:6977475-6977497 TTGTCAAATGTCTCTTGGAGGGG + Intronic
1201853788 Y:18518621-18518643 TTGACAATGGTTTCCTGGGTAGG - Intergenic
1201879533 Y:18801763-18801785 TTGACAATGGTTTCCTGGGTAGG + Intronic