ID: 1140739470

View in Genome Browser
Species Human (GRCh38)
Location 16:77928233-77928255
Sequence CCTGGTGACCAGAGAGATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140739470_1140739474 3 Left 1140739470 16:77928233-77928255 CCAACATCTCTCTGGTCACCAGG 0: 1
1: 0
2: 2
3: 25
4: 206
Right 1140739474 16:77928259-77928281 CCCTCTAGCAAATGTGTGTGTGG 0: 1
1: 0
2: 0
3: 15
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140739470 Original CRISPR CCTGGTGACCAGAGAGATGT TGG (reversed) Intronic
901510715 1:9716897-9716919 CCTGGTGTCCAGGGAGTGGTTGG + Intronic
902169235 1:14597723-14597745 CCTGTTGACCAGAGGGTTGCTGG + Intergenic
902458792 1:16555273-16555295 CCTGGTCACCAGACAGAAATGGG - Intergenic
902493364 1:16852643-16852665 CCTGGTCACCAGACAGAAATGGG + Intronic
903151980 1:21416031-21416053 CCTGGTCACCAGACAGAAATGGG - Intergenic
905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG + Exonic
906727307 1:48053557-48053579 TCTGGTGGCCAGAGAGAACTAGG - Intergenic
907261625 1:53222523-53222545 CCTGCTGACTAAAGAGCTGTTGG + Intergenic
907565033 1:55426537-55426559 CCTGGGGACGAGGAAGATGTGGG - Intergenic
908896097 1:68901545-68901567 CTTTGTTACCAGAGTGATGTTGG - Intergenic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
910659784 1:89659479-89659501 CCTGGAGCCCAGAGATATTTGGG + Intronic
912245147 1:107954265-107954287 CCTGCTTCCCAGAGAAATGTAGG + Intronic
913081484 1:115391570-115391592 CCTGAGGACCAGAGAGTAGTGGG - Intergenic
913606853 1:120475112-120475134 CCTGGTCACCAGACAGAAATGGG + Intergenic
913988489 1:143586496-143586518 CCTGGTCACCAGACAGAAATGGG - Intergenic
914209580 1:145565030-145565052 CCTGGTCACCAGACAGAAATGGG - Intergenic
914268499 1:146057398-146057420 CCTGGTCACCAGACAGAAATGGG - Intergenic
914368593 1:147003465-147003487 CCTGGTCACCAGACAGAAATGGG + Intergenic
914584340 1:149046724-149046746 CCTGGTCACCAGACAGAAATGGG - Intronic
919011928 1:191975811-191975833 CCTAGTGACCTGAGAGTAGTTGG + Intergenic
923803436 1:237232672-237232694 ACTGGTTACCAGTGAGAAGTAGG + Intronic
1062999318 10:1899842-1899864 CCTGCTGACCAGAAATATTTTGG - Intergenic
1063897608 10:10698389-10698411 CCTTGTATCCCGAGAGATGTTGG - Intergenic
1064103131 10:12480061-12480083 CCCAGTGACCAGAGATGTGTGGG - Intronic
1064265296 10:13820917-13820939 CCTCCTGTCCAGAGAGATGGGGG - Intronic
1065497986 10:26349677-26349699 CCTAGAGACCAGTTAGATGTAGG + Intergenic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1067544749 10:47184782-47184804 GCTGGTGGTCAGAGAGGTGTTGG - Intergenic
1068472498 10:57482767-57482789 CCTGGTGTCAAGAGAGGTATTGG + Intergenic
1071118024 10:82246551-82246573 CCTGGTTACCAGTGAAATCTGGG + Intronic
1071398746 10:85248739-85248761 CTTGGGAACCAGAGAGATTTGGG - Intergenic
1071507525 10:86241544-86241566 CCTGGTGACCAGATAGCGGTGGG - Intronic
1074497294 10:113991351-113991373 CCTGGGGCCCAGAGAGATCAAGG - Intergenic
1076581357 10:131514006-131514028 CCTGGTGAACAGAGAGGGGCAGG + Intergenic
1076931989 10:133537429-133537451 CCTGGTGACCAGAGAGGTGGAGG + Intronic
1077419046 11:2440994-2441016 CCTGGTGAGCTGAGGGATGTCGG + Intergenic
1078433576 11:11306315-11306337 CTTGGTGATCAGAAGGATGTAGG + Intronic
1079373767 11:19873585-19873607 CCTGATGGCCAGAGAGATCTAGG + Intronic
1079699906 11:23532365-23532387 CCTGGAGACCAGTGGGATGAGGG - Intergenic
1080351093 11:31386555-31386577 CCAGCTGACTAAAGAGATGTTGG + Intronic
1081874945 11:46402066-46402088 CTGGGGGACCAGAGAGAAGTGGG - Intronic
1084093338 11:66893864-66893886 CTTGGTGACCAGGGAGAGGGTGG - Intronic
1084893570 11:72249707-72249729 CCAGGGGACCAGAGGGATGGGGG - Intergenic
1085846217 11:80068604-80068626 CCTGGTGACTAGCTAAATGTAGG + Intergenic
1088475636 11:110235885-110235907 CTGGGGGACCAGAGAGTTGTCGG - Intronic
1090346407 11:126075192-126075214 CCTGGGGGCCAGAGAGAGGCTGG + Intergenic
1091537802 12:1429689-1429711 CCAGGTCTCCAGAGAGATTTAGG + Intronic
1091965767 12:4740099-4740121 CCTGGAGAAAAGAGAGATTTGGG + Intronic
1092011362 12:5115422-5115444 CCTGGAGACCATGGAGATGCAGG + Intergenic
1093246174 12:16739889-16739911 CCTGGTAGCCAGAGAGCGGTGGG - Intergenic
1096658515 12:53106372-53106394 CCTAGTGGCCAGAGAAATGAGGG + Intronic
1098105149 12:67061989-67062011 CTTGGTGACCAGGTAAATGTCGG - Intergenic
1098418358 12:70263057-70263079 AATGGTGGCCAGAAAGATGTAGG - Intronic
1099267932 12:80471228-80471250 CCTGGTTACTTGAGAGCTGTGGG + Intronic
1100617458 12:96242066-96242088 CCTGGTAACCTGAGCGATGCTGG - Intronic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1104471424 12:129032889-129032911 CCTTGTGAGCAGAGGGATGCAGG - Intergenic
1109336702 13:61003661-61003683 CCTGCTGACCAAAGAGCTGTTGG - Intergenic
1110371304 13:74743559-74743581 CCTGGGGACCAGGGGGAAGTGGG - Intergenic
1111973931 13:94946009-94946031 CCTGGTGATCAGTGAGACGGGGG - Intergenic
1112656066 13:101453731-101453753 CTTGGACCCCAGAGAGATGTGGG + Intronic
1113601919 13:111575620-111575642 TCTGGGGACCAGAGAGAAGATGG - Intergenic
1114484969 14:23056949-23056971 GCTGGGGACCAGAGAGAAGGCGG + Intronic
1114659131 14:24333816-24333838 CCTGGTGGCCAGGGAGGTGCGGG - Intronic
1116749736 14:48868380-48868402 CCTACTGACCAGAGAGAGATGGG + Intergenic
1118378876 14:65201505-65201527 CCTGGAGCCCAGAGAGAAGGGGG + Intergenic
1121013151 14:90533670-90533692 CCTGGTGACCACTGGGCTGTGGG - Exonic
1122205353 14:100145488-100145510 CCTGCTGACCTGGGAGATGCAGG - Exonic
1122829616 14:104389413-104389435 GCTGATGCCCAGAGAGATGTGGG + Intergenic
1123035226 14:105469255-105469277 CTTGCTGGCCAGAGAGCTGTGGG + Intronic
1127182234 15:56433494-56433516 CTTGGTGACCAGTGAGATCTAGG - Intronic
1127901694 15:63345719-63345741 CCTGGAGCCCAGAGAGAGGCAGG + Intronic
1129224921 15:74163641-74163663 CTTCGGGATCAGAGAGATGTGGG + Intergenic
1131479766 15:92770741-92770763 ACTGGTGACCACAGATATGTGGG + Intronic
1131706691 15:95003877-95003899 CCTGGTGACTTGAGACACGTAGG - Intergenic
1135120384 16:19761319-19761341 GCAGGAGACCAGAGAGATGAAGG - Intronic
1135424368 16:22324987-22325009 CCTGGGGACCAGAGGGGTGTTGG + Intronic
1135495898 16:22950862-22950884 ACTGGTGACCACAGACATCTGGG + Intergenic
1140623856 16:76769252-76769274 CCTGGTGTTCAGAGTGATGTGGG + Intergenic
1140739470 16:77928233-77928255 CCTGGTGACCAGAGAGATGTTGG - Intronic
1140899386 16:79353945-79353967 CATGGAGACCAGAGATAAGTGGG + Intergenic
1141108365 16:81252105-81252127 CCTGGTGACCACAGGAAAGTAGG - Intronic
1141849481 16:86635453-86635475 CCTGGTAACCAGAGAAAAGCAGG + Intergenic
1142088835 16:88199413-88199435 CCTGAAGACCAGGGACATGTGGG - Intergenic
1144404933 17:14942963-14942985 CCTGGTGGGCAGGGAGTTGTAGG + Intergenic
1149868106 17:60161728-60161750 CCTGGTGACCACGCAGCTGTGGG + Intronic
1150872609 17:68930093-68930115 CCTGGTGTCCAGAGAAATAAAGG - Intronic
1152025998 17:77809635-77809657 ACTGAGGACCAGAGAGATTTGGG - Intergenic
1153369409 18:4297184-4297206 CCTGGGGCTCAGAGAGATTTAGG + Intronic
1155333406 18:24740606-24740628 CCTGGTGATGAGAGAGGTCTTGG - Intergenic
1156615937 18:38784194-38784216 ACTGGATAGCAGAGAGATGTTGG - Intergenic
1157758330 18:50238757-50238779 TCTGGTGCCCAGAAAGATGTTGG - Intronic
1159097283 18:63918590-63918612 CCTCCTGCCCAAAGAGATGTTGG - Intronic
1160616721 18:80136399-80136421 GCTGGAGACCAGAGTCATGTGGG - Exonic
1163703537 19:18799143-18799165 CCTGGCGTGCAGAAAGATGTGGG - Intergenic
1163704576 19:18804716-18804738 CCTTGTGCCCGGAGAGATGTGGG - Intergenic
1164738303 19:30558641-30558663 CCTGGTGGGGAGAGAGGTGTGGG + Intronic
1165064076 19:33219063-33219085 ATGGCTGACCAGAGAGATGTAGG + Intronic
1165259917 19:34604314-34604336 CATAGTGACCACAGGGATGTGGG - Intronic
1166716629 19:44972780-44972802 CCTGGTGACCACAGGGCTGCAGG - Intronic
1167189526 19:47974859-47974881 TGAGGTGACCAGAGAAATGTTGG - Intronic
1167576975 19:50322499-50322521 CATGGAGACCAGAGAGAGATGGG - Intronic
1167725799 19:51211921-51211943 CCTGGGGCCCAGGGAGATGGGGG - Intergenic
1202708741 1_KI270714v1_random:4860-4882 CCTGGTCACCAGACAGAAATGGG + Intergenic
926152243 2:10431850-10431872 CCTGGTGTCTAGAGAAATGAAGG + Intergenic
926790871 2:16570269-16570291 CCTGGTTACCATTAAGATGTAGG + Intronic
927108105 2:19844914-19844936 GCTGGAGCCCAGAGAGGTGTGGG - Intergenic
927483733 2:23474321-23474343 GCTGGTGAACAGAGAGGTCTAGG - Intronic
927505793 2:23613791-23613813 CCTGGTGAGCTGAGAGTGGTGGG - Intronic
929230901 2:39558917-39558939 CCAGATAACCAGAGAGAGGTTGG - Intergenic
932190159 2:69734572-69734594 ACTGGTGACCACAGACATCTGGG - Intronic
932190251 2:69735342-69735364 ACTGGTGACCACAGACATCTGGG - Intronic
933307204 2:80616552-80616574 CATTCTGACCAGACAGATGTAGG - Intronic
933772908 2:85755078-85755100 CCTGGTGCCCAGACAGGTGTGGG + Intronic
935126818 2:100231515-100231537 CCTGGAGACCAGAAAGATGGCGG - Intergenic
935606286 2:104974957-104974979 CTTTGGGACCACAGAGATGTGGG - Intergenic
936018240 2:108975506-108975528 CTTGGTGACCAGATGGATGCCGG + Intronic
937165533 2:119812322-119812344 CTTGGTGAACAGAGAAATGCTGG - Intronic
939301319 2:140343906-140343928 CCTGGTGATGGGAGAGAAGTGGG + Intronic
940097723 2:149996891-149996913 CTTGGTCACCAGAGAAATGATGG - Intergenic
946471615 2:219966027-219966049 CCTGATGCCCAGAGCGATATGGG + Intergenic
947741768 2:232487938-232487960 CCAGGTGGCCCGAGAGATGCAGG - Intergenic
947775820 2:232708513-232708535 GCTTTTGAACAGAGAGATGTGGG + Intronic
947829074 2:233126013-233126035 CCTGGTGACCAGAGGGAGATGGG + Intronic
948967585 2:241395534-241395556 CCAGGTGACCACAGGGATCTGGG - Intronic
1169076539 20:2763304-2763326 CCTGGGGACCAGAGAGCTTCTGG + Intergenic
1173926436 20:46784672-46784694 CCTGGTGACCTGAGGGAGGGAGG + Intergenic
1175708322 20:61198316-61198338 CCTGCTGACCAGAAAGACTTGGG - Intergenic
1175951973 20:62588434-62588456 CCTGGTGGCCACACAGGTGTGGG - Intergenic
1176088961 20:63310497-63310519 CCTGGTGACCACAGGTAGGTGGG + Exonic
1178526091 21:33330709-33330731 CCTAGTGAGCAGAGAAAAGTGGG + Intronic
1178583655 21:33855883-33855905 CCTGGGGACCAGGCAGATGCAGG - Intronic
1179590971 21:42407562-42407584 CCTGGTTACTAGTGAGAGGTTGG - Intronic
1181314265 22:21961616-21961638 CCTGGTGACCATGGCGATCTTGG - Intronic
1181447481 22:22988797-22988819 CCTGGGCAGCAGAGAGATCTTGG - Intergenic
1181658539 22:24321878-24321900 CCTGGTAACCAGAGCGATGGAGG + Exonic
1181773311 22:25142427-25142449 CCTGGTGACCATGGAATTGTTGG - Intronic
1183583583 22:38739539-38739561 GCTGGTGCCCAGGCAGATGTGGG + Intronic
1183680944 22:39328802-39328824 CCTGGTGCTAAGAGATATGTTGG - Intergenic
1183906958 22:41048959-41048981 CCTGGTGGCCTGAGAGCTGCGGG + Intergenic
1185134503 22:49062112-49062134 CCTGGTGTCCAGACCCATGTAGG - Intergenic
950123868 3:10499717-10499739 CCTGGGCACCAGAGAGAGGCTGG - Intronic
950565329 3:13766597-13766619 CATGGTGTGCAGAGAGATGGTGG - Intergenic
951922650 3:27873179-27873201 TCTGCTGACCTGAGAGAGGTAGG - Intergenic
952052246 3:29398394-29398416 CCTGATGACCAGAGAGAAAAAGG - Intronic
953099862 3:39813262-39813284 CCAAGTGACCCGGGAGATGTGGG + Intronic
953875363 3:46663592-46663614 CCTGATGTCCAGAGAGTTCTTGG + Intergenic
954638000 3:52081921-52081943 CCTGGTGACGAGTTAGATGGGGG + Intronic
956298704 3:67744460-67744482 CCAGAGGACCAGAGAGATTTGGG - Intergenic
957942747 3:87025794-87025816 CCTGGTGACGAAACTGATGTTGG - Intergenic
959127495 3:102307874-102307896 CCTGCTGCCTAGAGAGATCTTGG + Intronic
960498541 3:118406859-118406881 CTAGGGGACCAGAGAGATGCTGG + Intergenic
961816047 3:129550943-129550965 CCAGGGGACCAGAGAGAAGGTGG - Intronic
962312193 3:134334488-134334510 CCTGGTGAGCAGAAAGGTGGTGG + Intergenic
962721461 3:138179068-138179090 CATTGTGTCCAGAGTGATGTTGG + Intergenic
962829281 3:139125810-139125832 CCTGCTGAGCAGACAGAAGTGGG + Intronic
962870813 3:139491520-139491542 CCTGGTGACTAAAGAGCTCTTGG - Intergenic
962962602 3:140324883-140324905 GATGGTGACCACAGAAATGTGGG + Intronic
963076597 3:141353126-141353148 CCTGGTGAACTGAGGGATTTGGG - Intronic
968787412 4:2632922-2632944 CCTGGTGCCCAGAGAGACTCTGG + Intronic
969339188 4:6529689-6529711 TCTAGTGGGCAGAGAGATGTGGG - Intronic
969865745 4:10076110-10076132 CCTGGGGAGCAGAGAGCTGGTGG - Intronic
971324358 4:25631892-25631914 ACTGGAGACCAGACAGGTGTGGG + Intergenic
975577358 4:75876364-75876386 CCTGGTGACCGGAGAGAAAGAGG - Exonic
975803258 4:78085493-78085515 CCTGGTGATGACAGAGCTGTAGG + Intronic
976226753 4:82800207-82800229 CCTGGAGACCAGATAAATGTCGG + Intergenic
977850733 4:101824322-101824344 GCTGGTGTCCAGGAAGATGTGGG + Intronic
980201393 4:129659624-129659646 ACTGGTTAACAGACAGATGTTGG - Intergenic
982274047 4:153621828-153621850 CCTGCTGCCCAGAGAGAGGCAGG + Exonic
984084278 4:175289127-175289149 CCTGGTTACCTGAGAGCTCTGGG - Intergenic
984184707 4:176529762-176529784 AGTGGTTACCAGAGAGATGAGGG - Intergenic
984824372 4:183911293-183911315 CCTGATGACCAGAGTAATGAGGG + Intronic
986376651 5:7138949-7138971 CCTGATGACCACAGAGAGGCTGG - Intergenic
989384730 5:40844078-40844100 CTTTGTGACCAGAGAGATATGGG + Intronic
993814326 5:92522510-92522532 CCTGGGGACCAGAGAGTAGAAGG + Intergenic
994914133 5:105950860-105950882 CCTGCTTACCAGAGAGATGCAGG + Intergenic
997522873 5:134534534-134534556 CCTGGTCAGCTGAGAGATCTGGG + Intronic
1001204432 5:169748971-169748993 GCTTTTGACCAGAGAGATGTGGG - Intronic
1001815875 5:174669089-174669111 CCAGGTGACCAGATGGATGGTGG + Intergenic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002201335 5:177530378-177530400 CTTGGTGACCAGCAAGATGGTGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1002770077 6:282880-282902 CATGATGCTCAGAGAGATGTGGG + Intergenic
1003059523 6:2851898-2851920 CCTGGTGAATAGAGACATGCAGG + Intergenic
1003985374 6:11429747-11429769 TCAGGTGGCCAGAGAGATGGAGG + Intergenic
1006454447 6:34123859-34123881 GCTGGAGACCAGAGAGAGGAAGG - Intronic
1006569717 6:34992200-34992222 CCTGGTTCCCAGAGAGGTCTGGG - Intronic
1006914633 6:37586306-37586328 CCTGATGACCAGACTGATGCTGG + Intergenic
1007654105 6:43441871-43441893 GCTGGAGACCAGACAGAGGTGGG + Exonic
1007821889 6:44566482-44566504 CCTGATGACCAGAGAGTAATGGG - Intergenic
1010658986 6:78546893-78546915 ACTGGTGAGCAAACAGATGTTGG + Intergenic
1011607300 6:89117843-89117865 CCTGATGAACAGGGAGGTGTTGG + Exonic
1014214954 6:118744579-118744601 CCTGGAGAGCAGAAAGAGGTTGG - Intergenic
1017580252 6:155857023-155857045 CCTGGAGACCACAGAGGTGTGGG - Intergenic
1018173499 6:161160551-161160573 CCTGGTAAACAGAGGGAAGTTGG - Intronic
1019148822 6:169990909-169990931 CCTGGTGTCAGGAGGGATGTGGG - Intergenic
1022223611 7:28340332-28340354 CCTGCTGACTAAAGAGTTGTTGG - Intronic
1023495970 7:40797513-40797535 TCTGTTGACCAGATGGATGTGGG - Intronic
1024246394 7:47473321-47473343 CCTGGAGATCAGAGAGATTAAGG + Intronic
1032905213 7:136356896-136356918 CCTGATGACCGGAGACATCTAGG - Intergenic
1033607545 7:142938414-142938436 CCTGGTGAGCACAGATCTGTTGG - Intergenic
1034203715 7:149298260-149298282 CCTGGTGCCAAGAGAAATGATGG - Intergenic
1035239386 7:157520048-157520070 CCTGGTCCCCAGGGAGATGACGG + Intergenic
1035350986 7:158246316-158246338 CCTGGTGACCAAAGACATCCTGG + Intronic
1035588434 8:794820-794842 CCTGGTGACCTGAGTGAGGTTGG + Intergenic
1038561970 8:28588635-28588657 CCTGGAGGCCAGAGAGGTGAGGG + Intergenic
1038895609 8:31778333-31778355 GGTGGTGACCAGAGAGAGGCTGG - Intronic
1040747635 8:50664600-50664622 CATGGTGCCCAGAGAGATGAGGG - Intronic
1043504068 8:80885714-80885736 CCTGGTGACCAACAGGATGTGGG + Intergenic
1045352234 8:101352502-101352524 CCTGGTGAGCAGGGAGGTGGCGG - Intergenic
1048225089 8:132577481-132577503 CCTGGTTCCCAGGGAGATGTTGG - Intronic
1050418483 9:5438245-5438267 CCTGCTGCTCAGAGAGATGTCGG + Intergenic
1050691678 9:8234379-8234401 CCTGCTTACCAGGGAGGTGTGGG + Intergenic
1052589563 9:30473780-30473802 CCTGATGACTAGGGAGAGGTGGG - Intergenic
1052832330 9:33226707-33226729 GCTGGTGACCTGAGAGAGCTGGG - Intronic
1054783128 9:69184562-69184584 CCTGTTGGCAAGAGAGATGGGGG + Intronic
1055489244 9:76787924-76787946 CTTGGTGACCATGGAGATGTGGG - Intronic
1061071173 9:128311578-128311600 CCACGTGACCAGAGAGAAGCTGG - Exonic
1061164754 9:128915927-128915949 CCTGGTGCACAGGCAGATGTTGG + Intronic
1062117227 9:134815950-134815972 CCTGGTGACAAAGGAGATGATGG + Exonic
1062416199 9:136451527-136451549 TCTGGTGACCAGAGGGAGGCAGG + Intronic
1185631528 X:1519022-1519044 ACTGGGGACCAGAGAGATTAGGG - Intronic
1195582342 X:106520459-106520481 CCTAGTGACCAGCGAGATGTAGG + Intergenic
1195701799 X:107711313-107711335 CTTGATGACCAGAGAGGTTTGGG + Intergenic
1195981978 X:110588709-110588731 CCTGGTGTCCAGTGAAAGGTGGG + Intergenic
1196755774 X:119156027-119156049 CCTGAGGACCAGAGAGCTGGAGG - Intergenic
1197418177 X:126202572-126202594 ACTGGTGTCCAGAGAGTTTTAGG + Intergenic
1197974358 X:132150329-132150351 CTTGGTGATCAGAGAGCTGGAGG + Intergenic
1198494500 X:137177819-137177841 CCTGGTGACCGAAGGGATGGTGG + Intergenic
1198531253 X:137550923-137550945 CCTGGCGACCAGAGAGGGCTTGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200296930 X:154929354-154929376 ACTGGTGATCAAAGAGAGGTTGG - Exonic