ID: 1140739988

View in Genome Browser
Species Human (GRCh38)
Location 16:77932917-77932939
Sequence CTACAGAAACAGAGGGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140739988 Original CRISPR CTACAGAAACAGAGGGACAT TGG Intronic
900033290 1:386630-386652 GTACAGAGACAGAGGGAGAGGGG - Intergenic
900054128 1:616519-616541 GTACAGAGACAGAGGGAGAGGGG - Intergenic
902969320 1:20035145-20035167 GTACAGAAAGAGAGGGAGAGAGG + Intronic
903988350 1:27246256-27246278 CTACAGAGACAGAAAGAGATGGG - Intronic
905110239 1:35589553-35589575 ATACAGAAAGAGAGACACATGGG - Intronic
905151236 1:35930022-35930044 TTACTGAAGCATAGGGACATGGG + Intergenic
905547827 1:38813920-38813942 CTCCAGAAGCAGAGGAACCTGGG - Intergenic
905821109 1:40992150-40992172 CAACAGGAAGAGGGGGACATGGG - Intronic
908673215 1:66572032-66572054 GTACAGAGACAGAGAGACATTGG - Intronic
908679766 1:66647751-66647773 CTGCATAAACAGAGGGACACTGG - Intronic
910406407 1:86895925-86895947 CTAAAGAAATAGTGGGATATAGG + Intronic
911476272 1:98377284-98377306 CTGCAGATACTGAGGGACAATGG - Intergenic
911569620 1:99507599-99507621 CTTCAGCAACAGAGGGAGAGGGG - Intergenic
912553246 1:110497916-110497938 CAACAGGAGCAGAGGGACACTGG + Intergenic
913529258 1:119721898-119721920 CTGCAGAAACACAGGGGCAGAGG + Intronic
915116802 1:153606489-153606511 GTACAGAGACAGAGGGACGGAGG - Intergenic
915823187 1:159047430-159047452 TTACAGTAACAGAGAGACAGTGG - Intronic
915864866 1:159488349-159488371 ATAAAGAAACAAAGGGAAATAGG - Intergenic
916439659 1:164810755-164810777 CTACAGAAAAAGAGGTAAACTGG - Intronic
916780460 1:168022001-168022023 CTACAGTAAAAGAGAAACATAGG - Intronic
917367443 1:174247860-174247882 ATACAGAGACAGAGGGAGAGGGG - Intronic
918186577 1:182132852-182132874 CTACAGAAAAGGAGGGTCACAGG + Intergenic
918475065 1:184915772-184915794 AGACAGAGACAGAGAGACATAGG + Intronic
918777785 1:188657621-188657643 TTACAGAAACACATGGACACAGG + Intergenic
920097054 1:203493045-203493067 CCACAGATACAGAGGGCCAACGG - Intergenic
921433365 1:215088189-215088211 CTTCAGAAACCGAGGGAAGTGGG - Intronic
922255649 1:223890784-223890806 GTACAGAGACAGAGGGAGAGGGG - Intergenic
922618135 1:226975052-226975074 ATCCAGACACAGAGAGACATTGG + Intronic
922637164 1:227185644-227185666 CTACAGAGACAGAGGGAGGGGGG - Intronic
923018532 1:230145462-230145484 CAACAAAAACAGAGGGAAATGGG - Intronic
923723264 1:236485105-236485127 CTACAGAAACTGATGGTTATTGG + Intergenic
924336845 1:242993649-242993671 GTACAGAGACAGAGGGAGAGGGG - Intergenic
1066471311 10:35700879-35700901 ATACAGAGACAGAGGGAGAGGGG - Intergenic
1067169266 10:43892809-43892831 CTTCAGAAACACAGGATCATGGG - Intergenic
1067353237 10:45496685-45496707 GTAAAGAAATAGAGGTACATAGG + Intronic
1068362216 10:55991868-55991890 CTAAAGAAACAGAGGAATACAGG - Intergenic
1069024722 10:63527339-63527361 CTAAAGAGACAGAGGGAAATGGG - Intronic
1069839911 10:71333335-71333357 GCACAGAAACACAGGCACATAGG - Intronic
1071808595 10:89152658-89152680 CCACAGATGCAGAGGGACAAAGG - Intergenic
1072204527 10:93191103-93191125 CTACAGAAGTAAAAGGACATAGG + Intergenic
1072388200 10:94954428-94954450 CTTGTGAAAGAGAGGGACATCGG - Intronic
1074051833 10:109887462-109887484 CTGTAGAAACAGAGGTAGATGGG - Intronic
1074530637 10:114296590-114296612 CTAAAGAAACAGACTCACATAGG - Intronic
1076282327 10:129258809-129258831 CCTCATAAACAGAGGGCCATCGG + Intergenic
1077338551 11:2016104-2016126 ACACAGAAGCAGAGGGAGATGGG - Intergenic
1078142333 11:8701495-8701517 GTACAGAGACAGAGGGAGAGAGG - Intronic
1078562298 11:12383658-12383680 CTACAGAAAAAGATGTACTTTGG - Intronic
1079495465 11:21038445-21038467 ATACAGAAACAGAAGGCCAAGGG + Intronic
1084719074 11:70892583-70892605 CTTCAGCATCAGATGGACATGGG + Intronic
1085237219 11:75024336-75024358 CTGCAGAAACTGAGGGAAAGTGG + Intergenic
1085535765 11:77216428-77216450 CCACAGAATGAGAGGGGCATGGG - Intergenic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086563612 11:88198016-88198038 CTACAGAAACTGAGGTATTTTGG + Intergenic
1087799118 11:102484767-102484789 CTACAGACTAACAGGGACATAGG + Intronic
1088739270 11:112753495-112753517 ATACAGAAAAAGAGTGACCTGGG + Intergenic
1089084764 11:115807495-115807517 CTAAAGAAACAGAGGCACAAGGG - Intergenic
1089116754 11:116101437-116101459 CAACATAAGCAAAGGGACATTGG + Intergenic
1089166390 11:116480517-116480539 CTACAGAGAGAGGGGGACAGAGG + Intergenic
1091048631 11:132348297-132348319 CAAAACAAACAGAGCGACATGGG + Intergenic
1202821535 11_KI270721v1_random:71286-71308 ACACAGAAGCAGAGGGAGATGGG - Intergenic
1091461465 12:646543-646565 CCAGAGAAAAAGAGGGACAGAGG + Intronic
1092224817 12:6741263-6741285 CCAGAGATAAAGAGGGACATTGG + Intergenic
1094124521 12:27009399-27009421 CTAAAGAAATAGAGGAATATCGG - Intronic
1094601937 12:31916575-31916597 CTACAAAAAGAGAGCGACAAGGG - Intergenic
1095987650 12:48010373-48010395 CTACTGGAAAAAAGGGACATAGG - Intergenic
1096418477 12:51434690-51434712 CTAGAGAAACAGAGGGAGGGAGG - Intronic
1097473857 12:60029482-60029504 GAACAGAAACAGAGGGAGAGAGG - Intergenic
1099788664 12:87301211-87301233 CTACAGAGACATAGGGTCAGAGG + Intergenic
1102363897 12:112314487-112314509 TTACAGAAACAGACGGATCTAGG - Exonic
1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG + Intronic
1103198116 12:119063857-119063879 AGACAGAAACAGAGAGAGATGGG + Intronic
1103602150 12:122061242-122061264 CCACAGAAACAGAGAGGCGTAGG + Exonic
1104168299 12:126255265-126255287 CAACAGAAAAAGAGTGAGATGGG + Intergenic
1104198580 12:126565748-126565770 CTACAGAATGAGAGGGAGAAAGG - Intergenic
1106323170 13:28661123-28661145 CTGCAGAATCACAGGGATATTGG + Intronic
1106489849 13:30210618-30210640 TTACTGCAACAGAGGCACATAGG - Intronic
1107336733 13:39363365-39363387 CTTTAGAGACAGAGGGACCTAGG + Intronic
1108915027 13:55597926-55597948 CTCCAGATACAGAGAGACAATGG - Intergenic
1111326978 13:86711127-86711149 ATAAAGAAACAGAGGCACAGGGG - Intergenic
1111607019 13:90552281-90552303 CTAAAGAAATAAAGGAACATAGG + Intergenic
1112050494 13:95640794-95640816 ATACAGAAATAGAGGGACTGTGG + Intronic
1112594670 13:100796912-100796934 CTGCAGAACCACAGGGAGATGGG + Intergenic
1112873867 13:104011335-104011357 CTATAGATAGATAGGGACATAGG + Intergenic
1113117201 13:106886173-106886195 CTTCAGAAACAGGGGGAACTAGG - Intergenic
1115269802 14:31539227-31539249 CAACAGAAACAGCTGGAAATGGG - Intronic
1117056746 14:51919973-51919995 CAACAGATACAGAGGGACAACGG - Intronic
1117060742 14:51960088-51960110 CTAAAGAAGCAGAGAGATATGGG - Intronic
1119499527 14:75112357-75112379 CTAGAGGAACAGAGGGATAAAGG + Intronic
1120134830 14:80855564-80855586 CTACAAAAAAAAAGGGGCATTGG + Intronic
1120244994 14:81995842-81995864 CTACAGAAAAGGAAGGAAATGGG - Intergenic
1121688399 14:95856719-95856741 CCACAGAAGCAGAGAGAGATTGG - Intergenic
1121708078 14:96015700-96015722 CTACTGAAACACAATGACATCGG + Intergenic
1122036064 14:98950239-98950261 AGACAGAGACCGAGGGACATGGG + Intergenic
1122653764 14:103243009-103243031 GTACAGAAACAGAGGGATGGGGG + Intergenic
1124226879 15:27902684-27902706 CCAGGGAAACAGAGGGACTTTGG + Intronic
1125889541 15:43255368-43255390 AGACAGAAACAGAGGGACCCAGG + Intronic
1126155604 15:45563028-45563050 CTACATTAAGAAAGGGACATTGG + Intergenic
1127169653 15:56287707-56287729 TTACAGAAACAGAGAGAAAATGG - Intronic
1129066920 15:72912839-72912861 CTTCAGAAACCGAGGGCCATTGG - Intergenic
1129091239 15:73152983-73153005 CTCCAGAAACAGCAGAACATGGG - Intronic
1133247549 16:4459215-4459237 CTACAAACACAGAGGGGCAGGGG - Intergenic
1133523177 16:6578618-6578640 TGGGAGAAACAGAGGGACATAGG + Intronic
1135230831 16:20706377-20706399 CTACAGAAACAAAGGAAGCTAGG + Intronic
1135612510 16:23880821-23880843 AGACAGAGACAGAGAGACATGGG - Intronic
1136352386 16:29719390-29719412 GTACAGAGACAGAGGGAGAGGGG - Intergenic
1136402667 16:30027065-30027087 CTGCAGAGAGAGAGGAACATGGG - Intronic
1137933308 16:52609136-52609158 CTACAGGAACAGTGTGACATTGG - Intergenic
1138964449 16:62067302-62067324 CTACAGAGACCTAGGGAAATAGG - Intergenic
1139262584 16:65609273-65609295 CCACGGAAAGAGAGGGTCATTGG - Intergenic
1140739988 16:77932917-77932939 CTACAGAAACAGAGGGACATTGG + Intronic
1145719591 17:27057640-27057662 CTACATAAACAGAGTGACGACGG + Intergenic
1145828089 17:27892600-27892622 GTACAGAGACAGAAGTACATTGG + Intronic
1145866891 17:28247487-28247509 CTACAGCAACAGAGCCACACAGG - Intergenic
1148085319 17:44990362-44990384 TGAGAGAAACAGAGAGACATGGG + Intergenic
1148816088 17:50329205-50329227 GTAGAGGAACAGAGGGACAAGGG + Intergenic
1149970453 17:61213057-61213079 ATACAGAAAAAGTGTGACATGGG - Intronic
1151198510 17:72449980-72450002 CATCAGAAAGAGATGGACATTGG + Intergenic
1151830356 17:76545652-76545674 CTAAAGAAACTGAGGCACAGAGG - Intronic
1153623262 18:6999639-6999661 CTACAGAAAGGAAGGGACATAGG + Intronic
1155038854 18:22048028-22048050 GTACAGGAAAAGAAGGACATTGG - Intergenic
1155765269 18:29622666-29622688 CTAAAGAAACAAAGGGTCATGGG + Intergenic
1156901551 18:42306091-42306113 CAAAAGAAACAGAGGGTCATAGG + Intergenic
1157003256 18:43551933-43551955 GTAGAGAAAGAGAGAGACATGGG - Intergenic
1158089476 18:53694039-53694061 GTACAGAGACAGAGGGAGAGGGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158619398 18:59018778-59018800 ATATAGAAACAGAGGGAGAGTGG + Intergenic
1159509831 18:69381821-69381843 ATACAGACACAGAGAGACAGGGG - Intergenic
1164460951 19:28446863-28446885 GTACAGAGACAGAGGGAGAGGGG - Intergenic
1165924389 19:39318285-39318307 CTTCAGAGAGAGAGAGACATGGG - Intergenic
1166692842 19:44834115-44834137 TGACAGAAACAGAGAGACAGAGG + Intergenic
1167160271 19:47763061-47763083 CTACAGAAACAGCCGGAAGTTGG + Intergenic
1167858828 19:52266654-52266676 CCACAGAAACAGAGAGATACAGG - Intergenic
1168269946 19:55244364-55244386 CTGGAGAAACACATGGACATGGG + Intronic
925114874 2:1370011-1370033 GTACAGAAGCAGAGGGTCAAGGG + Intergenic
927082605 2:19645451-19645473 CTCCAGAAAAAAAAGGACATTGG + Intergenic
927355864 2:22172354-22172376 CCACAGATACAGAGGGCCAATGG + Intergenic
927383949 2:22511422-22511444 ATACAGACACAGAGGGAAGTTGG - Intergenic
927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG + Intronic
930708554 2:54528431-54528453 CTACAGTTACTGAGGGACCTAGG - Intronic
933103539 2:78290875-78290897 ATAAAGAGACAGAGGGGCATAGG + Intergenic
934135787 2:88995209-88995231 GTACAAAGACAGAGGGACAGGGG - Intergenic
934233158 2:90205305-90205327 ATACAGAGACAGAGGGACAGGGG + Intergenic
934234528 2:90218566-90218588 GTACAGAGACAGAGGGACAGGGG + Intergenic
935178539 2:100670454-100670476 CTAGGGAAGCACAGGGACATCGG + Intergenic
936610057 2:113993540-113993562 CTACAGAGACAGAGGTCCAGTGG - Intergenic
938143582 2:128815346-128815368 CCATAGAAACTGAGGGACAAAGG + Intergenic
940639586 2:156332696-156332718 CCACATAAACAAAGGCACATTGG - Exonic
941252584 2:163184746-163184768 CTATAGAATAAGAAGGACATAGG + Intergenic
941597645 2:167497617-167497639 CTAAAGAACCTGAGGGAGATTGG + Intergenic
945531401 2:210958142-210958164 CAATGGAAACAGAGGGTCATTGG - Intergenic
945556594 2:211283551-211283573 ATACATAAACAGAGAGCCATGGG + Intergenic
946284734 2:218694403-218694425 CTCCAGAAACAGATGCAAATTGG - Intronic
947489070 2:230578466-230578488 CCCCAGAAACACAGAGACATGGG - Intergenic
947972062 2:234332870-234332892 CCAGACAAACAGAGAGACATGGG - Intergenic
1169759438 20:9075407-9075429 CTGCAGAAACAGAAGTACCTAGG - Intronic
1170997822 20:21381350-21381372 CTACATAAACTGACGGATATAGG - Intronic
1171202971 20:23256535-23256557 CCACAGAAACAGAGTCACACAGG - Intergenic
1172380848 20:34489759-34489781 GTACAAAAACAGCTGGACATAGG - Intronic
1173420791 20:42899229-42899251 CGAAAGAAACAGATGGCCATGGG + Intronic
1176185828 20:63778447-63778469 CCACAGAAACACAGGGGCATGGG + Intronic
1178127730 21:29533677-29533699 AGAAAGAAACAGAGGGAAATAGG - Intronic
1179103641 21:38378662-38378684 CTACACTTAAAGAGGGACATAGG - Intergenic
1181329115 22:22075330-22075352 CTGCAGACACAGATGCACATGGG - Intergenic
1182609379 22:31534061-31534083 ATACACAAAGAGAGGGAGATGGG - Intronic
1182955709 22:34423953-34423975 CTAGAGACAAAGAGGGATATTGG - Intergenic
1183044739 22:35210816-35210838 CTACAGAAGCAGAAGGAAAATGG + Intergenic
1184420169 22:44376277-44376299 AGACAGAAACATAGGCACATGGG + Intergenic
949110017 3:248606-248628 AAACAAAAACAGAGGGACAGAGG - Intronic
949357105 3:3192670-3192692 CTACAGGAACACAATGACATTGG - Intergenic
950124103 3:10501077-10501099 CTAAAGAAACAGAGGTCCCTGGG - Intronic
950279670 3:11696019-11696041 ATAGAGAAACAGACAGACATAGG + Intronic
951051299 3:18096956-18096978 CTACAGAAACAGAAAGTCAGAGG - Intronic
954082396 3:48220251-48220273 ATAGAGAGACAGAGGGACAGGGG + Intergenic
955740782 3:62089360-62089382 TAACAGAAAAAGAGGAACATGGG - Intronic
955797100 3:62648752-62648774 CTACAGAAACGGGGGGAAAGTGG - Intronic
957651969 3:83019373-83019395 CCACAGAGACGGAGGCACATGGG - Intergenic
958428960 3:94015174-94015196 CTACAGAAACAGAGGAACAAGGG - Exonic
958489884 3:94758897-94758919 GTACAGAAGCAGAGAGAGATCGG - Intergenic
958574244 3:95927060-95927082 CTACAGAAACAGAGGGAGGGGGG + Intergenic
959957935 3:112260344-112260366 CTAAAGAAAAAAATGGACATAGG - Intronic
960158739 3:114325955-114325977 GAACAGTAACAGAGGGAGATTGG - Intergenic
960185779 3:114636736-114636758 AGACAGCAACAGAGGGACAAAGG + Intronic
960925502 3:122792148-122792170 CTAGAGAAACAGAGGATCAGAGG + Intronic
962335140 3:134522773-134522795 CTAAAGAAAATGAGGTACATTGG - Intronic
962458906 3:135591058-135591080 CTACAGAGACAGAGGGAGGGTGG - Intergenic
965325572 3:167299788-167299810 GGACAGAAAAAGAGGGAAATAGG + Intronic
965920481 3:173907448-173907470 CTACAGAAATGTAGGGAAATAGG - Intronic
966802027 3:183773166-183773188 CCACAGATACAGAGGGCCAATGG + Intronic
967210168 3:187161474-187161496 CTAGAGAAACAGAAGCACAGAGG - Intronic
967500348 3:190190324-190190346 CTACATAAACAGAAGCACTTTGG + Intergenic
968774993 4:2535510-2535532 CCACAGACACAGAGGCACAAAGG - Intronic
970301791 4:14689067-14689089 CTGCAGATACAGATGTACATAGG - Intergenic
970318725 4:14854857-14854879 CCACAGATACAGAGGGCCAATGG + Intergenic
971579846 4:28322263-28322285 ATATAGAAACAGATGGATATTGG + Intergenic
971729737 4:30361729-30361751 CCACAGAAAGACTGGGACATTGG - Intergenic
973787605 4:54348177-54348199 CTACAGAATGAGAGAGACATGGG - Intergenic
975391189 4:73819466-73819488 TTAAAGAAACAGATGGATATGGG + Intergenic
975464714 4:74696346-74696368 CTACATAAACAGATGGGTATGGG + Intergenic
975583160 4:75924953-75924975 CTACAGAGACAGGGAGACAGGGG - Intronic
975989391 4:80241614-80241636 CAAAAGAAACAGAGGAAGATAGG - Intergenic
976038376 4:80852431-80852453 CCACAGAAAGAGAGAGACAGAGG + Intronic
976881978 4:89937489-89937511 CAACAGAAACAGAGGGAGAGTGG + Intronic
977222483 4:94354409-94354431 CTACAGGAACAAAGGGAAAGAGG + Intergenic
979240279 4:118441655-118441677 GTACAGAGACAGAGGGAGAGGGG + Intergenic
982683604 4:158461419-158461441 ATAAAGAAACAGAGGCACAGAGG + Intronic
982919118 4:161251901-161251923 AAACAGAGACAGAGGGACAGGGG + Intergenic
983089323 4:163485696-163485718 CTACAGAAACAGGAAGAAATTGG + Intergenic
984362306 4:178750562-178750584 CTTGAGAAATAGAGGAACATAGG - Intergenic
985061697 4:186086440-186086462 CTTCAGAACCAGAGGTACAGTGG - Exonic
985824764 5:2183914-2183936 GCAGAGAAACAGAGGGACAGTGG - Intergenic
986859176 5:11905389-11905411 CTGCTGAATCAGAGGGACAGGGG - Intergenic
986937814 5:12913019-12913041 CTATATAACCAGAGGGACAGAGG - Intergenic
987842074 5:23234626-23234648 GTACAGAGACAGAGGGAGAGAGG - Intergenic
989639751 5:43571503-43571525 TTACAGAAACAGATAGACAAAGG + Intergenic
990976332 5:61564777-61564799 CTGCAGCCACAGAGGGCCATGGG + Intergenic
992478548 5:77127544-77127566 CTAAAGAAACTGAAGGACCTGGG - Intergenic
996470800 5:123857965-123857987 TGACAGAAACAGAGGGACAACGG + Intergenic
997147945 5:131457780-131457802 CCACAGATACTGAGGGACAATGG + Intronic
997906346 5:137821606-137821628 CTTCTGAGACAGAGGGAAATAGG - Intergenic
998397799 5:141830375-141830397 TTAGAGAAACAGAGGGAGAGAGG - Intergenic
998455374 5:142268716-142268738 ATACAGAGACAGAAGGACAGGGG + Intergenic
999334309 5:150702090-150702112 CTACAGAAACAAGGGAACTTTGG - Intergenic
1001094817 5:168767991-168768013 ATGCAGATACAGAGGGAAATGGG - Intronic
1001449529 5:171813628-171813650 CTCTAGAATCATAGGGACATTGG - Intergenic
1001907286 5:175483727-175483749 CCAGAGACACAGAGGGACCTAGG - Intronic
1002378811 5:178809759-178809781 CCACAGAAACACAGGGCAATGGG + Intergenic
1002740530 5:181432238-181432260 GTACAGAGACAGAGGGAGAGGGG + Intergenic
1007867873 6:44993350-44993372 CTACAGAAAAATAGGGATCTAGG + Intronic
1008247465 6:49195502-49195524 GTATACAAACAGAGGGATATAGG - Intergenic
1008621227 6:53273345-53273367 CTGCAGGAACAGAGGGATTTGGG + Intronic
1009354858 6:62730444-62730466 CAACAGAAACATATGGAAATTGG - Intergenic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010424506 6:75712316-75712338 CTACAGAAAAATAGAGACCTAGG + Intronic
1010942639 6:81936794-81936816 CTACAGCAGGAGAGAGACATGGG - Intergenic
1011627029 6:89291132-89291154 CCACAGAATCAGAGGAACCTAGG - Intronic
1011752931 6:90471670-90471692 CTAGAGAAACACAGAGACACAGG - Intergenic
1012128132 6:95455872-95455894 CAACAGAAACAGAGATAAATAGG + Intergenic
1012857781 6:104523491-104523513 CTAGAACAACAGATGGACATTGG + Intergenic
1015153073 6:130060629-130060651 CTATAGAATCAGACAGACATGGG - Intronic
1015469472 6:133587415-133587437 CTAGAGAAATAGAGGCATATCGG + Intergenic
1018479580 6:164176553-164176575 GTCCATAGACAGAGGGACATGGG - Intergenic
1018990765 6:168671689-168671711 CCACAGAAGCAGAGGGACCAGGG - Intronic
1018993857 6:168695670-168695692 CCCCAGAAACAGAGGACCATAGG - Intergenic
1019033029 6:169029957-169029979 GCCCAGAAACAGAGGGACAGAGG - Intergenic
1019245640 6:170707835-170707857 GTACAGAGACAGAGGGAGAGGGG + Intergenic
1022305801 7:29145821-29145843 ATACAGAAACAAAAGGACTTTGG - Intronic
1025185092 7:56851441-56851463 CTAAAGAAAAAAAAGGACATTGG + Intergenic
1025686840 7:63725523-63725545 CTAAAGAAAAAAAAGGACATTGG - Intergenic
1026566854 7:71496397-71496419 CTAGAGAAACAGCAGGGCATAGG + Intronic
1026842863 7:73680251-73680273 CGACAGAAACAGTGGGGCAAGGG - Intergenic
1026921961 7:74162345-74162367 CTGCAGAGACAGAGGGGCACTGG + Intergenic
1031916079 7:127564244-127564266 CTACATAAACAGAGGGCTAGAGG + Intergenic
1032739664 7:134725849-134725871 CTACAAAGACAGAGGCACATTGG + Intergenic
1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG + Intergenic
1033575066 7:142673280-142673302 CTTCAGAGATAGAGGGACAGTGG - Intergenic
1035502484 8:100363-100385 GTACAGAGACAGAGGGAGAGGGG - Intergenic
1035592755 8:829368-829390 CTTGAGAAACAGAGAGACCTCGG - Intergenic
1036982570 8:13486981-13487003 CCACAGAAGCACAGGGAGATGGG - Intronic
1039533599 8:38287146-38287168 CTACAGAAATAGATGCACAAAGG + Intronic
1040934932 8:52772657-52772679 AGACAGAAGCAGAGGGTCATAGG + Intergenic
1041078510 8:54190925-54190947 CTACAGATCCTGAGGGATATTGG + Intergenic
1041335562 8:56778882-56778904 CTTCAGAAAGAGAGGGGCTTGGG - Intergenic
1041481481 8:58324831-58324853 CTACAAAAAGAGAAGGAAATGGG + Intergenic
1041786099 8:61636366-61636388 CTATAGAGACAGAGGGAGAGAGG + Intronic
1042584281 8:70318067-70318089 CCACAAAAACAAAGGAACATTGG + Intronic
1043422646 8:80114705-80114727 CTACATCAACAGAGGCACAGGGG - Intronic
1045502532 8:102754274-102754296 CTCCAGGAACAGAGGGGCAGAGG + Intergenic
1047830156 8:128620811-128620833 CCACAGATACAGAGGGACAATGG - Intergenic
1048024377 8:130571370-130571392 CAACAGAAACACAGAGACAGCGG + Intergenic
1048509935 8:135053171-135053193 CTGCAGATACAGAGGGCCAATGG - Intergenic
1048768051 8:137865955-137865977 CTAAAGAAGCAGAGGAACTTTGG - Intergenic
1049159297 8:141087090-141087112 ATACAGAGACGGAGGGACCTGGG + Intergenic
1049339827 8:142106103-142106125 GTGCAGGGACAGAGGGACATAGG + Intergenic
1049339852 8:142106261-142106283 ATGCAGAAACAGAGGGACACAGG + Intergenic
1050090734 9:2015328-2015350 GTACAGAAACAGAGGGAGAGAGG - Exonic
1051857639 9:21587305-21587327 CTATAGACACTGAGTGACATTGG + Intergenic
1054800193 9:69339994-69340016 CTACAGAAAGAGAGTGAAAAAGG - Intronic
1055591041 9:77814105-77814127 CAAAAGAAACAGAAGGACAGAGG + Intronic
1055795631 9:79972203-79972225 GAATAGAAACAGGGGGACATTGG + Intergenic
1056155217 9:83827850-83827872 CTCAAGATACAGAGAGACATGGG + Intronic
1056355270 9:85795263-85795285 CTCAAGATACAGAGAGACATGGG - Intergenic
1057790713 9:98122973-98122995 CTACAGAAACTAACGGACACTGG - Exonic
1059253602 9:112909098-112909120 ACACAAAAACAGACGGACATAGG + Intergenic
1059525695 9:114989195-114989217 CACCACAAGCAGAGGGACATAGG - Intergenic
1060317935 9:122530421-122530443 CTACAGATACAGGGAGTCATGGG + Intergenic
1061426178 9:130499764-130499786 CGACAGTAACAGAGGGTCCTAGG + Intronic
1061996634 9:134189495-134189517 ATACAGAGACAGAGGGAGAGTGG + Intergenic
1203605839 Un_KI270748v1:57046-57068 GTACAGAGACAGAGGGAGAGGGG + Intergenic
1185544173 X:928790-928812 GGACAGAAACAGAAGGACAGGGG + Intergenic
1185595909 X:1306825-1306847 AGAGAGAAACAGAGAGACATAGG + Intronic
1186132685 X:6485584-6485606 ATACAGAAAAAGTAGGACATAGG + Intergenic
1189921100 X:45903992-45904014 CCACAAAAACAGAGGGAGAAGGG + Intergenic
1189941034 X:46121234-46121256 CTACACAAACAGTGGTACAGGGG + Intergenic
1190961798 X:55257556-55257578 ATACAGAAACAGATGAGCATAGG + Intronic
1193414849 X:81209487-81209509 ATCCAGAAACATAGGTACATTGG + Intronic
1194809219 X:98370462-98370484 TTAAAGAAACAGGGAGACATAGG + Intergenic
1195393038 X:104382940-104382962 ACACAGAAACAGAGAGACAGAGG - Intergenic
1196409847 X:115406785-115406807 CTGCAGAAACAGAGCCACAAAGG - Intergenic
1197172906 X:123454298-123454320 ATGCAGAAACAGAGGCACAGAGG - Intronic
1198496251 X:137196413-137196435 CTCCAGGAACAGAGAGACTTTGG - Intergenic
1199834915 X:151580068-151580090 ATACAGAAACAGAAGCACAGAGG - Intronic
1199918087 X:152366274-152366296 CTACAGGAACAGAGACACTTGGG + Intronic
1201728560 Y:17182027-17182049 TTACAGAGAAACAGGGACATAGG - Intergenic
1202388015 Y:24343484-24343506 GTACAGAGACAGAGGGAGAGGGG + Intergenic
1202482772 Y:25326644-25326666 GTACAGAGACAGAGGGAGAGGGG - Intergenic