ID: 1140740385

View in Genome Browser
Species Human (GRCh38)
Location 16:77936382-77936404
Sequence GCTGCCTGCGTGGTGACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140740385_1140740389 0 Left 1140740385 16:77936382-77936404 CCTCAAGTCACCACGCAGGCAGC 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1140740389 16:77936405-77936427 CCTTTCTGCCTCATTGCACCTGG 0: 1
1: 0
2: 0
3: 17
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140740385 Original CRISPR GCTGCCTGCGTGGTGACTTG AGG (reversed) Intronic