ID: 1140740389

View in Genome Browser
Species Human (GRCh38)
Location 16:77936405-77936427
Sequence CCTTTCTGCCTCATTGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140740386_1140740389 -10 Left 1140740386 16:77936392-77936414 CCACGCAGGCAGCCCTTTCTGCC 0: 1
1: 0
2: 1
3: 20
4: 249
Right 1140740389 16:77936405-77936427 CCTTTCTGCCTCATTGCACCTGG 0: 1
1: 0
2: 0
3: 17
4: 211
1140740385_1140740389 0 Left 1140740385 16:77936382-77936404 CCTCAAGTCACCACGCAGGCAGC 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1140740389 16:77936405-77936427 CCTTTCTGCCTCATTGCACCTGG 0: 1
1: 0
2: 0
3: 17
4: 211
1140740383_1140740389 9 Left 1140740383 16:77936373-77936395 CCTCAGTCTCCTCAAGTCACCAC 0: 1
1: 1
2: 2
3: 19
4: 282
Right 1140740389 16:77936405-77936427 CCTTTCTGCCTCATTGCACCTGG 0: 1
1: 0
2: 0
3: 17
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140740389 Original CRISPR CCTTTCTGCCTCATTGCACC TGG Intronic