ID: 1140741299

View in Genome Browser
Species Human (GRCh38)
Location 16:77943813-77943835
Sequence CATAGCATGTGGCAGTTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140741294_1140741299 24 Left 1140741294 16:77943766-77943788 CCTCTAAGGAATGAAATTTCTAG 0: 1
1: 0
2: 2
3: 13
4: 193
Right 1140741299 16:77943813-77943835 CATAGCATGTGGCAGTTATTAGG 0: 1
1: 0
2: 0
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140741299 Original CRISPR CATAGCATGTGGCAGTTATT AGG Intronic
901146601 1:7069217-7069239 CATAGCATGTGGCATGCAGTAGG - Intronic
901362990 1:8720001-8720023 CAAAGCATCTGGCACATATTAGG - Intronic
901662908 1:10809862-10809884 CATGGCATGTGGCACCTCTTAGG - Intergenic
901850564 1:12012254-12012276 CAGAGCAGGTGGCAGTCACTGGG + Exonic
903424548 1:23244228-23244250 CATAGTATGTGGCAGAGATAGGG - Intergenic
913329791 1:117657992-117658014 CATACCATGTGCCAGGCATTGGG + Intergenic
913409448 1:118535147-118535169 CAGTGCATTTGGGAGTTATTAGG + Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
920029463 1:203027697-203027719 CATAGTATCTGGCAGATAGTAGG - Intronic
920384846 1:205563884-205563906 CCTAGCATCTGGCATTTAGTTGG - Intergenic
920704602 1:208242453-208242475 CATAGCTTGAGGCAGTCACTTGG - Intronic
1067489109 10:46681177-46681199 CACAGCATGTGGCACATAGTAGG - Intergenic
1067605564 10:47659196-47659218 CACAGCATGTGGCACATAGTAGG + Intergenic
1068896584 10:62210135-62210157 CATAATATGTGGCCCTTATTTGG + Intronic
1070638744 10:78150507-78150529 CAGAGCCTGAGGCAGGTATTTGG + Intergenic
1070962285 10:80507455-80507477 CAGAGCAGGTGGCAGCTCTTAGG + Intronic
1071621122 10:87120572-87120594 CACAGCATGTGGCACATAGTAGG + Intronic
1072292209 10:93974647-93974669 ATTAGCATGTGGATGTTATTAGG - Intergenic
1072962282 10:99940185-99940207 CAATGCATGTAGCATTTATTTGG + Intronic
1074837449 10:117311472-117311494 CATAGCACGTGGCATTCAGTGGG - Intronic
1078517252 11:12033435-12033457 CATAGCATGTGTCAGGTATATGG + Intergenic
1078567429 11:12428561-12428583 CATAGTATCTGGCACCTATTTGG + Intronic
1080303299 11:30809118-30809140 CATAGCAAGTGGCAGAAATGGGG - Intergenic
1081819068 11:45973607-45973629 AATAGCATTTGGCTTTTATTTGG - Intronic
1082660321 11:55901554-55901576 CATAGAATGTATCACTTATTAGG - Intergenic
1086113407 11:83222315-83222337 CATACTATGTGTTAGTTATTTGG + Intronic
1086758478 11:90595452-90595474 CAGAGCATCTGGCACATATTAGG + Intergenic
1087263663 11:96038888-96038910 TATAGTATGTGGCATTTAGTAGG + Intronic
1087771200 11:102212332-102212354 CATATCATGTGGCTGTTGTAGGG + Intronic
1087970489 11:104475237-104475259 CACAACATGTGGCATTTTTTGGG - Intergenic
1091796892 12:3302614-3302636 CATAGCATGTGGATTGTATTAGG - Intergenic
1092625591 12:10324294-10324316 CATTGCATGTTGCAGTGGTTTGG + Intergenic
1094045550 12:26162009-26162031 AATAGCATCTGGCACTTAATAGG + Intronic
1095463796 12:42469405-42469427 CGTAGCTTGTGGCAGTGATGTGG - Intronic
1099709653 12:86206924-86206946 CCTGGCATATGGCAGTTATTTGG - Intronic
1101597382 12:106179017-106179039 CATAGCATATTGCAGTTGTAGGG - Intergenic
1103686491 12:122736153-122736175 CACATCATGTGGGAGTTATGGGG - Intergenic
1107155624 13:37164124-37164146 TAAAGCATGTGTCAGCTATTAGG - Intergenic
1107850229 13:44563930-44563952 GTATGCATGTGGCAGTTATTTGG - Intronic
1108782612 13:53855138-53855160 CATAGCTTTTTTCAGTTATTTGG + Intergenic
1109529165 13:63618362-63618384 TATAGAATGTGGCAATTATGTGG + Intergenic
1111851425 13:93580554-93580576 CATAGCACGTGGCACATAATAGG - Intronic
1112684377 13:101806529-101806551 CTTAGCATCTGGGATTTATTAGG + Intronic
1115921472 14:38378944-38378966 CATATCACATGCCAGTTATTGGG + Intergenic
1116899432 14:50347733-50347755 CATAGCATATGGGTGGTATTTGG + Intronic
1116976175 14:51118641-51118663 CATAGAATTTGGCACTTTTTGGG - Intergenic
1118160578 14:63285773-63285795 CATAGCACCTGGCACATATTAGG - Intronic
1120458024 14:84757114-84757136 CCAAGCATGTGGCAGTCATGTGG - Intergenic
1121323578 14:93006955-93006977 CACAGCATGTGGCATTTGTCAGG - Intronic
1124916714 15:33982371-33982393 CATAGCATTTGGTAATTCTTGGG - Intronic
1125106271 15:35975187-35975209 CTTAGCATGTGCCAGTCACTGGG + Intergenic
1128371695 15:67044412-67044434 CATAGCCTGTGACAGCAATTTGG + Intergenic
1129828707 15:78652821-78652843 TAGAGCATGTCGCAGTGATTTGG + Intronic
1131432213 15:92395906-92395928 CCCAGCATGTGGAAGGTATTTGG - Intronic
1138890901 16:61143119-61143141 TATATCATGTGTCAGTTATTGGG + Intergenic
1140741299 16:77943813-77943835 CATAGCATGTGGCAGTTATTAGG + Intronic
1140970725 16:80009908-80009930 CAAAGCATGGGTCAGTTATTAGG + Intergenic
1140982600 16:80125253-80125275 CACTGAATGTGGAAGTTATTTGG - Intergenic
1141055092 16:80806300-80806322 CATAGCATGAGGATGTAATTTGG + Intergenic
1143380226 17:6491191-6491213 CATAGCATGTGGCATAGATAGGG + Intronic
1146733195 17:35213319-35213341 ACTAGCAGGTGGCAGTTAGTTGG + Intergenic
1148467258 17:47872605-47872627 CAAAGCAAGAGGCAATTATTTGG + Intergenic
1148785514 17:50144316-50144338 CATAGCATCTGGGGGTCATTTGG - Intronic
1149459622 17:56817189-56817211 GAAAGCATGTGACATTTATTTGG + Intronic
1150673851 17:67227009-67227031 AATAGCATGAGGGAGTTTTTAGG + Intronic
1151320741 17:73350865-73350887 CATAGATTGTAGCAGTTAGTAGG - Intronic
1151396944 17:73829407-73829429 CATACAATGAGGTAGTTATTTGG - Intergenic
1153047588 18:870956-870978 CATAACATGTGGGAATTATGGGG - Intergenic
1153520975 18:5953646-5953668 CATAGGATCTGGCACTTACTTGG - Intergenic
1154058583 18:11035902-11035924 CATAGGAAGTGGCAGAGATTTGG - Intronic
1155779132 18:29809019-29809041 CATTGCGTGGTGCAGTTATTTGG - Intergenic
1157103601 18:44752422-44752444 CAAGGAATGTGGCAGTTCTTGGG + Intronic
1157344316 18:46810491-46810513 CAAACCATGTTGCAGTTTTTTGG - Exonic
1157353481 18:46912345-46912367 CATAGCATTTGCCATATATTAGG - Intronic
1157416357 18:47506643-47506665 CATAGCATGTGGCAGAATTCTGG + Intergenic
1157936184 18:51875209-51875231 CATTACATCTGGCAGTTAGTGGG - Intergenic
1167576209 19:50319118-50319140 CCTAGCATGTGGTAGGTACTTGG + Intronic
927717241 2:25360698-25360720 CATAGCATATGGCATATAGTAGG + Intergenic
935742039 2:106158189-106158211 CAAAGCATGTGCCAGGTTTTGGG + Intronic
936861753 2:117027914-117027936 AATAGCATCTGGCAGTCATGAGG + Intergenic
937049379 2:118875993-118876015 CATGGCATGTAGCACTTAGTAGG - Intergenic
937454572 2:122030304-122030326 CATAGCCTGTGGTAGTTAGGTGG + Intergenic
938020926 2:127905235-127905257 CACAGCATCTGGCAAATATTAGG + Intergenic
939336808 2:140839758-140839780 CATACAAAGTGGGAGTTATTAGG - Intronic
939521231 2:143233168-143233190 CAAAGAATGTGGCAAATATTAGG - Intronic
940241111 2:151564071-151564093 CCTAGAATAGGGCAGTTATTTGG + Intronic
940972436 2:159908172-159908194 CAAATCATGTGCCAGGTATTAGG - Intergenic
941693395 2:168525398-168525420 CATTGTGTATGGCAGTTATTTGG + Intronic
945204556 2:207318380-207318402 AATTGCATTGGGCAGTTATTGGG + Intergenic
948681317 2:239636786-239636808 CATAGCTTGTCACAGTCATTAGG + Intergenic
1174051962 20:47773158-47773180 CTTAGCATGTGGCACATAGTAGG - Intronic
1174529906 20:51203192-51203214 CCTGGCATGTGGCAGGCATTCGG + Intergenic
1176970374 21:15258262-15258284 AATAGCATCTGACATTTATTGGG - Intergenic
1177054503 21:16284062-16284084 CATAGAATGTGAAACTTATTTGG - Intergenic
1179073228 21:38092835-38092857 CTTAATATGTGGCATTTATTTGG - Intronic
949766160 3:7529270-7529292 CCTATCATGTGTCAGTAATTAGG - Intronic
949781642 3:7695737-7695759 TACCGCATGGGGCAGTTATTAGG + Intronic
952425217 3:33168605-33168627 CATAGCATGATGCAGATATCAGG + Intronic
952475848 3:33709816-33709838 CACAACATGTGGCTGTTATTTGG + Intronic
954979246 3:54729232-54729254 CATAGCATTTGCCAATTAATAGG - Intronic
955033580 3:55244221-55244243 CATAGCATCAGGCACTCATTAGG + Intergenic
955440030 3:58945663-58945685 GACAGCATGTGGCAGCTAATTGG - Intronic
955796673 3:62644562-62644584 CATACCATGAGGAAGTTGTTAGG - Intronic
957227345 3:77466861-77466883 CATGACATCTGGCAGTTACTTGG + Intronic
957387146 3:79510619-79510641 CATAAAATGTTGCAGTGATTAGG + Intronic
959010920 3:101075020-101075042 CATAGCATGTTGCTTATATTGGG - Intergenic
959477347 3:106827092-106827114 TGTAGCATATGGGAGTTATTTGG + Intergenic
959808288 3:110585584-110585606 CATAGAATGTGACAGTATTTGGG + Intergenic
960021612 3:112962099-112962121 TAAAGTCTGTGGCAGTTATTAGG + Intronic
960598826 3:119434662-119434684 CATAGCATGTAGCACATACTAGG - Intronic
961914418 3:130357384-130357406 CAGAGCAATTGCCAGTTATTGGG - Intronic
962733472 3:138303798-138303820 AATAGCAGCTGGCATTTATTTGG + Intronic
965123364 3:164592729-164592751 CTTAGCAAGTGGCGGTTAATTGG - Intergenic
965479559 3:169200969-169200991 GATAGCTTGTGGGAGTTATAAGG - Intronic
966470101 3:180279672-180279694 CATAACAAGTGGCATTGATTTGG + Intergenic
967678200 3:192326246-192326268 TATAAAATGTGGAAGTTATTTGG + Intronic
967967239 3:194971608-194971630 CATTGCATGTGGCATTTCTCAGG - Intergenic
968095118 3:195923962-195923984 CATGACATGTGTCACTTATTTGG + Intergenic
971328460 4:25663278-25663300 CAAAGCATGTTGGAGTAATTGGG + Intronic
972702228 4:41505215-41505237 CATAGCATCTGGCACTTGCTTGG + Intronic
974407932 4:61499874-61499896 CATAGTATGTGTCAGTTTTAGGG - Intronic
975696380 4:77017911-77017933 CATAGCTTGAGCCAGTAATTTGG + Intronic
976837065 4:89386723-89386745 AATAGCATGAGGCAGTTATGAGG - Intergenic
977322955 4:95542725-95542747 TATATCATGTTGCAGATATTTGG - Intronic
979496686 4:121392035-121392057 TATAGCATGTGGCATATCTTGGG - Intergenic
984421722 4:179531556-179531578 CATAACATTGGCCAGTTATTTGG + Intergenic
985830008 5:2221299-2221321 CATAGCAGGGGGCAGTGGTTCGG + Intergenic
987248285 5:16072645-16072667 CACAACTTGTGGCAGATATTTGG - Intronic
992304562 5:75422742-75422764 CTTAGAATATGGCTGTTATTTGG + Intronic
995434009 5:112115315-112115337 CATAGCATCTGGCACATAGTAGG - Intergenic
996860234 5:128057255-128057277 CATAGTATGTGTCAGCTCTTGGG - Intergenic
1000433400 5:161179262-161179284 CATAGCATGTGGCTGTTCCTGGG - Intergenic
1000804603 5:165774311-165774333 CATAGAAGGTGGGGGTTATTTGG - Intergenic
1003398286 6:5771589-5771611 CATAGCATTTGTCTTTTATTTGG + Intergenic
1004805603 6:19201005-19201027 CATAACATGTGGGAATTATGTGG + Intergenic
1006250987 6:32784569-32784591 AATAGCATGTAGCACTTAGTAGG + Intergenic
1009055180 6:58326604-58326626 CATAGAATATGGCATTAATTGGG + Intergenic
1009235982 6:61123971-61123993 CATAGAATATGGCATTAATTGGG - Intergenic
1009591829 6:65682605-65682627 CATAGCATGTGATATATATTAGG - Intronic
1010224894 6:73479651-73479673 CGTATCATGTGGAATTTATTTGG + Intronic
1010529514 6:76950223-76950245 CATAGCATGTGGCAGATGTATGG + Intergenic
1011752119 6:90463868-90463890 CATCGCATGTGGCAGCTGCTGGG + Intergenic
1011885610 6:92091072-92091094 CATTGCATGTGGTATTTGTTGGG - Intergenic
1012626317 6:101407714-101407736 CATATTATGTGGCAGGCATTTGG + Intronic
1013660362 6:112289632-112289654 CACAGCATGTTGCAGTGACTTGG - Intergenic
1015015588 6:128408944-128408966 CATAGGATCTAGCAATTATTTGG + Intronic
1018237637 6:161741770-161741792 CATATCACATGGGAGTTATTTGG - Intronic
1018626230 6:165781451-165781473 CACCACATGTGGCAGTTAGTTGG - Intronic
1020580374 7:9991523-9991545 TACAGCATTTGGCATTTATTTGG - Intergenic
1025844347 7:65182842-65182864 CAAAGTATGTGGAAGTTTTTTGG - Intergenic
1025894676 7:65689176-65689198 CAAAGTATGTGGAAGTTTTTTGG - Intergenic
1026133810 7:67642010-67642032 CACAGCATGTGGCACCTACTAGG + Intergenic
1026134544 7:67647796-67647818 CATAGCGTCTGCCAGTAATTGGG + Intergenic
1028704033 7:93816925-93816947 CATAGCATGTGACTGTCATTAGG - Intronic
1029904747 7:104080137-104080159 CATACCCTGTGTCAGGTATTGGG - Intergenic
1030350566 7:108480857-108480879 CATAGCATGAGAGAGTTTTTGGG - Intronic
1030655762 7:112165920-112165942 TACAGAAAGTGGCAGTTATTTGG - Intronic
1031044535 7:116873097-116873119 CATACCATGTGGAAATTATAGGG + Intronic
1031720159 7:125164643-125164665 CCTCGCATGTGCAAGTTATTTGG - Intergenic
1035004905 7:155649382-155649404 CATAGCATGTGTTAGATATTTGG + Intronic
1035485727 7:159224252-159224274 CATTCTATGTGGCAGGTATTTGG + Intergenic
1036486312 8:9182612-9182634 CTCATCATGTGGCAGTAATTGGG - Intergenic
1039815914 8:41094325-41094347 CATAGCATGTGGCATCTCTAGGG - Intergenic
1040090086 8:43389320-43389342 CATATCATGTTCCAGTTCTTAGG + Intergenic
1041279107 8:56193821-56193843 AATAGCAGGTGCCAGCTATTTGG - Intronic
1043458299 8:80433885-80433907 CAGAGCAAGTAGCATTTATTTGG + Intergenic
1043653405 8:82629511-82629533 GACATCTTGTGGCAGTTATTTGG + Intergenic
1044457163 8:92401756-92401778 CATACTATGTGCCAGTTACTAGG - Intergenic
1044460493 8:92438884-92438906 CATAGCATTTGGCAGATAATAGG - Intergenic
1050023198 9:1306406-1306428 CTTACCATGTGTCATTTATTGGG + Intergenic
1055022035 9:71680370-71680392 CAGAGTATGTGGCTGTTACTGGG - Intergenic
1056851721 9:90090557-90090579 GGTAGAATGAGGCAGTTATTTGG - Intergenic
1058392081 9:104507007-104507029 CACAGCATGATGCTGTTATTTGG + Intergenic
1058658785 9:107249720-107249742 CATAGCATGTGACACATAGTAGG + Intergenic
1189886868 X:45555566-45555588 CATAGCATGTGGCATTAAGCAGG - Intergenic
1191823101 X:65335022-65335044 GATAGCTTATGGCAGTTATGAGG - Intergenic
1193221045 X:78927570-78927592 CATACCATGTGGAAGTTTTGGGG + Intergenic
1197795907 X:130298701-130298723 CATAGTGTGTGGTACTTATTTGG + Intergenic