ID: 1140741746

View in Genome Browser
Species Human (GRCh38)
Location 16:77947754-77947776
Sequence CCTCAAAAACAGAGGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140741746_1140741753 6 Left 1140741746 16:77947754-77947776 CCTACCTCCCTCTGTTTTTGAGG 0: 1
1: 0
2: 2
3: 29
4: 290
Right 1140741753 16:77947783-77947805 TTCGCTCTTGTTGTCCAGGCTGG 0: 343
1: 10433
2: 33506
3: 29345
4: 21749
1140741746_1140741755 20 Left 1140741746 16:77947754-77947776 CCTACCTCCCTCTGTTTTTGAGG 0: 1
1: 0
2: 2
3: 29
4: 290
Right 1140741755 16:77947797-77947819 CCAGGCTGGAGTTTGCGCAATGG 0: 1
1: 0
2: 1
3: 36
4: 352
1140741746_1140741752 2 Left 1140741746 16:77947754-77947776 CCTACCTCCCTCTGTTTTTGAGG 0: 1
1: 0
2: 2
3: 29
4: 290
Right 1140741752 16:77947779-77947801 GAGTTTCGCTCTTGTTGTCCAGG 0: 336
1: 10164
2: 32298
3: 29112
4: 19791

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140741746 Original CRISPR CCTCAAAAACAGAGGGAGGT AGG (reversed) Intronic
901232129 1:7647162-7647184 CCTCCGGAACAGAGGGAGGGAGG - Intronic
901342537 1:8508271-8508293 AGTCAAAAACAGAGAGAGGAAGG + Intronic
902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG + Intergenic
902514740 1:16984008-16984030 CTTGAAAAAAGGAGGGAGGTTGG + Intergenic
902530032 1:17085118-17085140 GGGCAAAAACAGAGGAAGGTGGG - Intronic
902837544 1:19056930-19056952 TCTCAAAAAGAGAGAGAGGCCGG + Intergenic
904450825 1:30610165-30610187 CCTCCGAAACAGAGGGAGGGGGG - Intergenic
904752252 1:32748293-32748315 ACTCAAAAAAAAAGGAAGGTGGG + Intronic
904964655 1:34362079-34362101 CCTAAAAAATAGAGGGCTGTGGG + Intergenic
906672136 1:47664120-47664142 TTTCAAAACCAGAGGGAGATAGG - Intergenic
907032181 1:51183389-51183411 CCTCAAATACAGAGAGGGATCGG + Intergenic
909772509 1:79441412-79441434 CCACAAAAACAGAGAGCTGTCGG + Intergenic
910613975 1:89177000-89177022 TCTCTAAAAGAGAGGAAGGTGGG + Intergenic
911744041 1:101419492-101419514 CCTTAAAAAAAAAGGGAGGCAGG + Intergenic
912062288 1:105687511-105687533 CCTCAAACTCAGAAGCAGGTGGG + Intergenic
912460590 1:109828378-109828400 CCTAAAAAACAGAGACAGCTGGG - Intergenic
914003923 1:143716537-143716559 TCTCAAAAAAAAAGGGAGGGGGG + Intergenic
915021490 1:152783980-152784002 TCTCAAAAAAAGGAGGAGGTGGG + Intronic
916964732 1:169925782-169925804 CCTCACAAACAGCCAGAGGTAGG - Intronic
917143169 1:171858300-171858322 CCTCAAAAACTGAGGCACATGGG - Intronic
917629727 1:176879852-176879874 CCTCCAAAACTGAGGGATTTGGG - Intronic
919085651 1:192917624-192917646 TCTCAGAGACTGAGGGAGGTAGG - Intergenic
919382924 1:196880696-196880718 CCTCAAAAAATGAGTGAGGGAGG + Intronic
919535988 1:198788583-198788605 CCTCAGCTACAGAGAGAGGTAGG - Intergenic
919827684 1:201515189-201515211 CCTCAAAAACAGTAGTAGGCAGG + Intergenic
920091071 1:203453632-203453654 CCTGAAAAAGAGAGTGAGGGTGG - Intergenic
921086522 1:211798932-211798954 CCTAGAAAAGAGAGGGAGGGAGG + Intronic
921433365 1:215088189-215088211 CTTCAGAAACCGAGGGAAGTGGG - Intronic
921889138 1:220336329-220336351 TCTCAAAAACAAAAGGAGTTTGG + Intergenic
923018532 1:230145462-230145484 CAACAAAAACAGAGGGAAATGGG - Intronic
923643035 1:235785050-235785072 CCTCAATAATAGAGGGAGACAGG - Intronic
924141250 1:241026202-241026224 CCTCACACACAGAGGGAACTCGG + Intronic
1063598759 10:7461446-7461468 TCTCAAAAAGGGAGGGAGGGAGG + Intergenic
1064349315 10:14561579-14561601 CCTCAAAACCACAGGGGGGAGGG + Intronic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1065824447 10:29557095-29557117 TCTCAAAAAGAAAGGGAGGGGGG - Intronic
1066000380 10:31099459-31099481 CCTCTGAAACAGGAGGAGGTGGG - Intergenic
1066002705 10:31119393-31119415 CCTCAAAATCAAAGGGAGTTTGG + Intergenic
1067243458 10:44516544-44516566 CATCACAAACAGATTGAGGTGGG + Intergenic
1069021635 10:63494946-63494968 TCTCACATACAGAGGGAAGTGGG - Intergenic
1069859641 10:71462359-71462381 CCTCTAAAGCAGATGGCGGTGGG - Intronic
1070612119 10:77940565-77940587 GCTCAGAACAAGAGGGAGGTGGG - Intergenic
1071421206 10:85501556-85501578 CCTCAAAAAATGAGTGAGGGAGG + Intergenic
1071652485 10:87406601-87406623 CCTCCAAAACAGGGGAAGGAAGG + Intergenic
1071757800 10:88564420-88564442 CCTGAAAATCAGAGGGTGGGGGG + Intronic
1071795879 10:89005164-89005186 CATCAAAAACGAAGGGAGGGAGG + Intronic
1072787055 10:98291015-98291037 CCTGAACAACAGAGGAAGGGAGG - Intergenic
1073277835 10:102328085-102328107 CGTCAAAAATAGATGGAGCTAGG - Intronic
1076282327 10:129258809-129258831 CCTCATAAACAGAGGGCCATCGG + Intergenic
1076492872 10:130875400-130875422 CCTGAAAACCAGCTGGAGGTGGG - Intergenic
1076845417 10:133066993-133067015 CTTCAAAAAAAGAGGAAGGCTGG + Intergenic
1077983145 11:7322016-7322038 CCTTAAAATCATACGGAGGTAGG - Intronic
1078224910 11:9383267-9383289 CTCTAAAAAAAGAGGGAGGTGGG - Intergenic
1078652744 11:13210790-13210812 CCTCAAAAAGGAAGGCAGGTTGG - Intergenic
1080141842 11:28931077-28931099 ACTCAAACACAGAGGGAGATGGG - Intergenic
1080850745 11:36067511-36067533 CCTCAACAACTGAGCAAGGTTGG + Intronic
1082875309 11:57981901-57981923 CCTCAAAAACTGAGAGAAGGTGG + Intergenic
1082890051 11:58129529-58129551 GATCAAAACCAGAGGGAGGTTGG - Intronic
1083601605 11:63952149-63952171 CCTCAGAATCACAGGGAGGAAGG - Intronic
1084420417 11:69057916-69057938 CCTCAAAAACAGGGCGAGCCAGG - Intronic
1084868009 11:72075598-72075620 ACTGAAAAACAAAGGGAGGAAGG - Intronic
1086820594 11:91432200-91432222 CCTAAAAAACACAGGGAGAATGG - Intergenic
1089185480 11:116611996-116612018 ACTCCAATACAGCGGGAGGTGGG - Intergenic
1091060695 11:132458875-132458897 CCTCATAAAGTGAGGGAGTTAGG + Intronic
1091762984 12:3099807-3099829 CCTCAAAAACACAGGGTATTCGG - Intronic
1096758015 12:53816262-53816284 CATGAAAAGGAGAGGGAGGTAGG - Intergenic
1098555457 12:71813722-71813744 CCTCTTAAACAGACAGAGGTAGG - Intergenic
1099503909 12:83448564-83448586 CCTCATAACCAGTGGGAGATAGG + Intergenic
1099982718 12:89625286-89625308 CCCCAAAAATAGAGGCAGCTGGG + Intronic
1100446313 12:94663558-94663580 CCTCAACAACAGTATGAGGTGGG - Intergenic
1100790483 12:98124857-98124879 CCTCAAAAGCAGAGGCAGGTAGG + Intergenic
1101489665 12:105199272-105199294 CATTAAAGTCAGAGGGAGGTGGG - Intronic
1101918686 12:108915749-108915771 CCCCAAATACAGAGGGATGGGGG - Intronic
1102143497 12:110636692-110636714 CCACAACAACAGAGGCAGCTGGG - Intronic
1103279029 12:119739242-119739264 CCTCTAAAACAGACTTAGGTAGG + Intronic
1103280687 12:119755820-119755842 CTTCAAAAACATAAGGAGGCTGG - Intronic
1105801863 13:23911936-23911958 CCTAATATACAGAGAGAGGTGGG - Intergenic
1105929141 13:25035281-25035303 TCTCAAAAAAAAAGGGAGGGGGG + Intergenic
1107737879 13:43417181-43417203 CCTCAGCAACAGAGGGAGACGGG + Intronic
1108774715 13:53751655-53751677 GCTAAAAAACAGAGGAAGGCTGG + Intergenic
1109667856 13:65562782-65562804 CCTTAAATACAGAGGGAAATTGG - Intergenic
1110020294 13:70461028-70461050 CCTCAAAAAATGAGTGAGGGAGG - Intergenic
1111084163 13:83351925-83351947 CCTTAAGAACAGAGGAAAGTAGG - Intergenic
1112562923 13:100529724-100529746 CCTCAAAACCACAGAGAGGGAGG + Intronic
1112797561 13:103072701-103072723 CCTCAGAAAAAGAGGGAATTTGG + Intergenic
1113613505 13:111664698-111664720 CCTTATAAAAAGAGGGAGTTTGG + Intronic
1113876559 13:113598222-113598244 CCCCAAAGACAGCGGGAGGCAGG + Intronic
1115663504 14:35521675-35521697 TTTGAAAAACAGAGGGAGTTTGG + Intergenic
1117036947 14:51739873-51739895 CCCCAAAAACAGGGGGAAGATGG + Intergenic
1117680296 14:58197025-58197047 CCTCAGAAGAAGAGGGAGGCCGG + Intronic
1119607514 14:76033422-76033444 CCTCCAAAACAGACGGAGCTTGG + Intronic
1119754819 14:77108772-77108794 ACTCAAAAGAAGAGGGAGGAGGG - Intronic
1121466321 14:94117724-94117746 CATCAAAGAAAGGGGGAGGTGGG - Intergenic
1123388062 15:19839358-19839380 TCTCAAAAAAGGAGGGGGGTGGG - Intergenic
1127244417 15:57156320-57156342 CCTAAAAAATAGAGTGAGGTGGG - Intronic
1127481871 15:59385156-59385178 CCTCAAAAACAAAAGGAGGCTGG - Intronic
1128000959 15:64191354-64191376 CCTCAAAAACAAATGCAGGCTGG - Intronic
1128028861 15:64461538-64461560 CCTCAACCCCAGAGGGAGGAAGG - Intronic
1128740290 15:70079039-70079061 CCTCATAACCAGAGTGAGCTGGG - Intronic
1129238530 15:74238124-74238146 CCTCAAAAATAAAAGGACGTTGG + Intronic
1130159445 15:81384123-81384145 CCTCACAAGCAGAGAGAGGAAGG - Intergenic
1132112383 15:99111407-99111429 CCTCTAAAACAGGGGAATGTAGG + Intronic
1134066380 16:11231207-11231229 CCAAAAAAACAGAGCCAGGTGGG - Intergenic
1136599298 16:31273812-31273834 CCTCAGAAACAGAGAGAGCCTGG - Intronic
1136995111 16:35183675-35183697 CCCCTAGAACAGAGGTAGGTTGG - Intergenic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138648362 16:58441858-58441880 ACTCAGGCACAGAGGGAGGTAGG + Intergenic
1140741746 16:77947754-77947776 CCTCAAAAACAGAGGGAGGTAGG - Intronic
1140804194 16:78518019-78518041 GCTCAAAGACATAGGAAGGTGGG - Intronic
1141093027 16:81143395-81143417 TCTCAAAAAGAGATAGAGGTCGG - Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141995098 16:87631751-87631773 GATCAAAAAAAGAGGTAGGTAGG - Intronic
1142560891 17:808189-808211 CCCCAGGAGCAGAGGGAGGTGGG - Intronic
1143570171 17:7753127-7753149 TATTAAAAACAGAAGGAGGTTGG + Intronic
1143761276 17:9105835-9105857 GCCTAAAGACAGAGGGAGGTGGG + Intronic
1143830982 17:9650690-9650712 CCACAAAAACATAGGTATGTTGG - Intronic
1144937415 17:18911274-18911296 CCTTAAAATCAGAGGAAAGTGGG - Intronic
1147948059 17:44091657-44091679 CCTCAACACCAGAGGGAAGATGG + Intronic
1148415199 17:47500905-47500927 CCTCACTACCAGTGGGAGGTGGG + Intergenic
1148703200 17:49604480-49604502 CCTCAGGCACAAAGGGAGGTAGG + Intronic
1148789249 17:50164200-50164222 TCTCAGAGACAGAGGGAGGGAGG - Intronic
1148797092 17:50202123-50202145 TCTCCAAAACAGAGGAAGCTGGG + Intergenic
1149207664 17:54267206-54267228 CCCCAAAGACAGAGGGAGGCGGG + Intergenic
1150462730 17:65366068-65366090 CCTGAAAATCAGAGCAAGGTGGG + Intergenic
1151201110 17:72468654-72468676 CCACACAAACAGGGAGAGGTAGG - Intergenic
1151385113 17:73750437-73750459 CAGCACAAACAGAGGGAGGTGGG + Intergenic
1151538798 17:74753725-74753747 CCAAAAAAACAGGGGGAGGGGGG + Intronic
1153614952 18:6925768-6925790 GCTCAGGCACAGAGGGAGGTGGG + Intergenic
1155391701 18:25345130-25345152 CTTTAAAAATAGAGGGAGGCAGG + Intronic
1156598822 18:38579708-38579730 CCAGAAGAACAGAAGGAGGTGGG + Intergenic
1156658177 18:39312177-39312199 CCCCACAAAAAAAGGGAGGTGGG + Intergenic
1156907376 18:42370100-42370122 CCTTCAAAACCAAGGGAGGTAGG + Intergenic
1158536155 18:58309801-58309823 CCACCCAACCAGAGGGAGGTGGG + Intronic
1159028029 18:63204394-63204416 CCACAAAAACAGAGAGGGGTTGG - Intronic
1160008173 18:75083769-75083791 CCTCTCAGAAAGAGGGAGGTCGG - Intergenic
1160323055 18:77914435-77914457 CCTCAAGAAAAGAGTGAGGCTGG - Intergenic
1161035168 19:2080377-2080399 CCTCAAAAAAAAAAAGAGGTGGG - Intronic
1161525483 19:4752400-4752422 GCTGAAAAACAGAGGGAGTTTGG - Intergenic
1162128103 19:8510395-8510417 CCTCAACCACAGCTGGAGGTGGG + Exonic
925274286 2:2637878-2637900 CCTCCAAAACAGAGGGCTGGGGG - Intergenic
926097408 2:10091176-10091198 TCTCAAAAAAAGAAGGAAGTAGG + Intergenic
927110534 2:19861145-19861167 CCACAAACTCAGAGGGAGGCTGG + Intergenic
927797347 2:26061756-26061778 TCTCAAAAACAAGGGGGGGTGGG - Intronic
928334635 2:30386096-30386118 TTTCAAAAGCAGTGGGAGGTTGG + Intergenic
928418135 2:31113799-31113821 ACTCAGGCACAGAGGGAGGTGGG + Intronic
930169876 2:48240466-48240488 GCTCAAAATCAGGTGGAGGTGGG + Intergenic
930283577 2:49400682-49400704 CCTCACATACAGATGGAGATAGG + Intergenic
931231096 2:60375455-60375477 CCACAGAATGAGAGGGAGGTGGG + Intergenic
931336935 2:61354968-61354990 CAGCAACAACAGAGGGATGTGGG - Intronic
931573826 2:63698734-63698756 ACTCAGAAAAAGAGGGAGGGGGG + Intronic
933646847 2:84820055-84820077 CCTCAAAAGCAGAGGTTGGTGGG + Intergenic
935014200 2:99164478-99164500 ACTCATAAACAGAGGGAGCTGGG - Intronic
936066730 2:109338026-109338048 CATCAAAAACAGAAGGAGCCTGG - Intronic
937832424 2:126438085-126438107 CCTGATAAAAGGAGGGAGGTGGG + Intergenic
942143225 2:172998963-172998985 CCTCTAAAAGAGATGGAGATTGG + Intronic
942594372 2:177578934-177578956 TCTCAAAAGCAGAGGCAGCTAGG - Intergenic
944443656 2:199767800-199767822 CCTCAAAAACTGTGAGAAGTAGG + Intronic
945136835 2:206638666-206638688 CCTTGAAAACAGAGGGAGAAAGG - Intergenic
945807634 2:214509638-214509660 TCTCAAAAACACAGGAAGGTGGG - Intronic
946749758 2:222882338-222882360 TCTCAGAAACACAGGAAGGTAGG - Intronic
947419399 2:229928646-229928668 CCACAAAAACAGCAGGAGTTTGG - Intronic
1168748295 20:263744-263766 CCACAAGAACACAGGGAGGCCGG - Intergenic
1169172992 20:3480594-3480616 CCTAACATACAGAGGGAGGGAGG + Intronic
1171462372 20:25305659-25305681 CTTTAAAAAAAGAGGGAAGTAGG - Intronic
1171996702 20:31737070-31737092 CCTCAAAAACAAAGGGATGGGGG - Intergenic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1175100189 20:56573916-56573938 CCTCTGAAGCAGAGGGAGGCAGG - Intergenic
1178921084 21:36738683-36738705 CCACTACAACAGTGGGAGGTGGG - Intronic
1179118396 21:38518320-38518342 CTTAAAAAAAAGAGTGAGGTAGG + Intronic
1179675412 21:42978017-42978039 TCTCAAAAAAAGAGGGAGGGAGG - Intronic
1181987201 22:26808370-26808392 CCTCAAATACAAAGGCATGTTGG - Intergenic
1183150852 22:36036369-36036391 TCCCACGAACAGAGGGAGGTAGG - Intergenic
1183443680 22:37838605-37838627 CCACCAAGACAGAGGGAGGAAGG + Intronic
1183628906 22:39021472-39021494 CTTCAAAAAAAGAGGGAGACTGG + Exonic
1183675287 22:39295829-39295851 CCTCAAAAACATAGATACGTAGG - Intergenic
1184123597 22:42471023-42471045 CCTGAGATACAGAGGGAGCTGGG - Intergenic
1184673901 22:46029898-46029920 CATCAAAAACCTAGGCAGGTGGG - Intergenic
1184730866 22:46370209-46370231 GCTCCAAAACAGATGGAGGACGG + Intronic
1184770506 22:46594312-46594334 CCACAAAAACAGGGGCAGGGAGG - Intronic
950475494 3:13211924-13211946 GCTCAAAAACACAGGGCCGTGGG - Intergenic
950648222 3:14391038-14391060 CCTCAAACATAGAGGGAAGGTGG - Intergenic
952943450 3:38460117-38460139 CCCCAAAAACAGATGGAACTAGG - Intronic
953320493 3:41966837-41966859 CCTCAAAAAAAAAGGAAGGAAGG + Intergenic
953374570 3:42417867-42417889 CATGAAGAACGGAGGGAGGTAGG + Intergenic
954521064 3:51227016-51227038 CCTCAAAAACAGAGAGAAGCAGG - Intronic
955166009 3:56512009-56512031 GCACAAAAACAGGAGGAGGTGGG + Intergenic
958258435 3:91351742-91351764 ACTCAAAAAGAGAGGAAGTTTGG + Intergenic
958574244 3:95927060-95927082 CTACAGAAACAGAGGGAGGGGGG + Intergenic
960208895 3:114935945-114935967 CCTCAAAATCAGAGAAAGGGGGG + Intronic
961176807 3:124842530-124842552 GCCCAAGGACAGAGGGAGGTCGG + Intronic
961787968 3:129358925-129358947 GCTCAAAAACACAGGGCCGTGGG + Intergenic
961796590 3:129413360-129413382 GCTCAGGCACAGAGGGAGGTCGG + Intronic
963230327 3:142903053-142903075 CCTCAATAAGAGAGGGACCTGGG + Intergenic
964308636 3:155368492-155368514 CCTCAAAAACCCAGTGAGGCTGG - Intergenic
964408980 3:156378863-156378885 ACCCAAAAACAGAGGGAGGAGGG + Intronic
965024053 3:163275524-163275546 CGTGAAAAAAAGAGGGAGGTAGG + Intergenic
965730582 3:171767939-171767961 CCTCAAAAAAAAAGAGAGGGGGG + Intronic
966007445 3:175033223-175033245 CCTCAGAAAAGGAGGGAGCTAGG - Intronic
966191542 3:177276298-177276320 CAACAAAAACACAGGGAGGCAGG - Intergenic
966438419 3:179916669-179916691 TCTCAAAAACAAAGGGGGGGTGG - Intronic
967184307 3:186931592-186931614 CCTCAAAAAAAGAGAGTGCTGGG + Intronic
967411390 3:189169744-189169766 CCTCAACAGCCCAGGGAGGTTGG + Intronic
967916654 3:194583508-194583530 CCTTAAAAACCGAGTGGGGTGGG + Intergenic
968242020 3:197098558-197098580 CCTGAGCAACAGAGCGAGGTGGG - Intronic
968485868 4:861292-861314 CGTCAAAAGCAGAGGAAGGCCGG + Intronic
968645022 4:1736121-1736143 CCTCTAAAACAGAGGTCGGCAGG + Intronic
971276463 4:25202473-25202495 CCTGAAAGTGAGAGGGAGGTTGG + Intronic
972992862 4:44843853-44843875 TCTCAAAAACAGAGAGAGACAGG - Intergenic
974167795 4:58226224-58226246 ACTCAAAAACAAAGGAAGGATGG + Intergenic
978283399 4:107044689-107044711 ACTCAGAAACAGAGGCAGGTAGG + Intronic
978897230 4:113903571-113903593 CCTCAGAAACTGAAGGAGGTTGG - Exonic
978941155 4:114437276-114437298 TGACAAAAACAGAGGAAGGTTGG + Intergenic
982634435 4:157875107-157875129 CCTTAAGAACAGAGGAAGGATGG - Intergenic
983420893 4:167515628-167515650 CCTCAAAAAAAGAGAGAGGCAGG - Intergenic
983721907 4:170865689-170865711 CCTCAGAAACACAGGGAGCAAGG - Intergenic
984172530 4:176377769-176377791 CCTCAAAAACAGAGGAATAATGG - Intergenic
985236874 4:187884808-187884830 ACACAAAAAGAGAGGGAGGCAGG - Intergenic
987841319 5:23225792-23225814 GCACAAAGACAGAGGGAGGGGGG - Intergenic
988190057 5:27918818-27918840 CATCAAAAACCAAGAGAGGTAGG + Intergenic
988844086 5:35112086-35112108 CCTGATTAACACAGGGAGGTCGG - Intronic
991297855 5:65100829-65100851 CTTCAAAAGGAGATGGAGGTGGG - Intergenic
991484740 5:67123220-67123242 CCTCAAAAACTGGTGGAGCTGGG + Intronic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
993827911 5:92715422-92715444 CCTCACACACTGGGGGAGGTAGG - Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994315368 5:98326884-98326906 ACTCAAAGACAGAGGGTGGAAGG - Intergenic
994699158 5:103111657-103111679 CCCAAAACACAGAGGGATGTGGG + Intronic
995857987 5:116614026-116614048 CCACAAAAGTAGAGGGAGGTGGG + Intergenic
996700534 5:126446268-126446290 TCTCAAAACCAGTAGGAGGTAGG + Intronic
998992353 5:147831860-147831882 CCACAACCACAGAGGGAGTTAGG - Intergenic
999317677 5:150594722-150594744 CCTCAACAACCTGGGGAGGTGGG + Intergenic
999623127 5:153491864-153491886 CCTCAGAAATACAGGGAGGGTGG - Intronic
1000412760 5:160950702-160950724 CCGCAAAAGCAGAGGGAGGTGGG - Intergenic
1003034634 6:2632277-2632299 CAGAAAAATCAGAGGGAGGTGGG + Intronic
1003635737 6:7829814-7829836 CGCCACAAGCAGAGGGAGGTTGG + Intronic
1003747305 6:9017133-9017155 CCTCAAAATCAGGAGGAGGATGG - Intergenic
1004153926 6:13150002-13150024 CCTCAAAAGCAGAGAGAGGCAGG - Intronic
1005273094 6:24187168-24187190 CCTTAAAAAAATAGGGAAGTTGG + Intronic
1006442253 6:34059923-34059945 CCACAAAAAGAGACTGAGGTAGG + Intronic
1008817373 6:55584539-55584561 TCTCAAAAACAGAGTGAGGAGGG + Intergenic
1008996826 6:57668945-57668967 ACTCAAAAAGAGAGGAAGTTTGG - Intergenic
1009043585 6:58211440-58211462 CCTCATAAAATGAGGGAGGGAGG - Intergenic
1009185341 6:60568279-60568301 ACTCAAAAAGAGAGGAAGTTTGG - Intergenic
1009267876 6:61579034-61579056 CAGCAGAAAGAGAGGGAGGTGGG + Intergenic
1010539672 6:77075883-77075905 CCTAAACAAAGGAGGGAGGTAGG + Intergenic
1011535258 6:88369808-88369830 CCTGAACCACAGAGGGAGGAGGG + Intergenic
1013673685 6:112433494-112433516 CCTCAAAACCAGGTTGAGGTTGG + Intergenic
1014479869 6:121922465-121922487 ACTCAAGCACAGAGGGAGCTAGG + Intergenic
1015282688 6:131450797-131450819 CCAAGAAAACAGAAGGAGGTTGG - Intergenic
1015845359 6:137514753-137514775 TCTCAAGAACAGAGGCAGCTGGG - Intergenic
1016330145 6:142946102-142946124 CCTTAAGGACAGAGGGAGGGCGG + Intergenic
1017220379 6:151959548-151959570 CCTCAAAAGCTGGTGGAGGTAGG - Intronic
1017337010 6:153272655-153272677 TCTCAAAAGCACAGGGAGGGAGG - Intergenic
1017411062 6:154168434-154168456 CCTCATAAATAGGGGGAGTTTGG - Intronic
1018173499 6:161160551-161160573 CCTGGTAAACAGAGGGAAGTTGG - Intronic
1018190871 6:161308143-161308165 GTTCAGAGACAGAGGGAGGTGGG + Intergenic
1018858403 6:167692106-167692128 GATCAGAAACAGAGGGGGGTGGG + Intergenic
1019674914 7:2305142-2305164 CCTCAGAAACAGCTGGAGGCAGG + Intronic
1022162628 7:27726936-27726958 CCAAAAAAAGAGAGGGAGGCAGG + Intergenic
1022259037 7:28686251-28686273 GCTCAAAAACAGAAGGCAGTAGG - Intronic
1022338660 7:29447640-29447662 CCTCAAAACCAGTGGTAGGAGGG + Intronic
1022444294 7:30457096-30457118 CCCCACAACCAGTGGGAGGTGGG - Intronic
1023362769 7:39432751-39432773 TCTCAGAACCAGAGGGAGGATGG - Intronic
1026993960 7:74604002-74604024 TCTCAAAAAAAAAGGGGGGTGGG + Intergenic
1028559852 7:92162363-92162385 GCTCAAAAAAAAAGGGAGGAGGG - Intronic
1029161859 7:98558219-98558241 CCTCAGAAAAAAAGGGAGGGAGG - Intergenic
1030158919 7:106487194-106487216 ACTGAAAAAGAGAGGGAGGGAGG - Intergenic
1030159460 7:106492611-106492633 ACTGAAAAACAGAGGGAAGGAGG + Intergenic
1033455437 7:141498984-141499006 CTTAAAAAGCAGAGGGTGGTTGG + Intergenic
1034193414 7:149227714-149227736 CCTCAAAAAAAGAGAGAGATAGG + Intergenic
1034349509 7:150407038-150407060 TCTCAAGGACAGGGGGAGGTAGG - Intronic
1035022935 7:155809554-155809576 CCCCTAAAACCGAGGGGGGTAGG - Intronic
1035062749 7:156081273-156081295 CCACAAAACCAGAGAGATGTAGG - Intergenic
1036112711 8:5921721-5921743 CCCCAAAAAAAGAGGGAAGGAGG + Intergenic
1036118044 8:5981599-5981621 CCTCAAAAACAGAGATGAGTGGG + Intergenic
1036751841 8:11448610-11448632 CCTGAAAATCTGGGGGAGGTGGG - Intronic
1037392608 8:18409647-18409669 GCTCAGGCACAGAGGGAGGTAGG - Intergenic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1038850300 8:31269028-31269050 TCCCAAAAAGAGAGGGAGTTGGG - Intergenic
1039371767 8:36991822-36991844 CCACAAAAAAAGAGAGGGGTAGG - Intergenic
1042401916 8:68359641-68359663 CCTTAAAAAGAGAGAGGGGTGGG - Intronic
1042515209 8:69652103-69652125 CCCAGAAAACAGAGGAAGGTGGG - Intronic
1042566977 8:70121465-70121487 CCCTAAAAACAGAGGAAGGGCGG - Intronic
1042985931 8:74582882-74582904 TTACAAAAACAGATGGAGGTGGG + Intergenic
1044508247 8:93046032-93046054 CCTCAAAAACTGAGTTAGGGAGG + Intergenic
1045844502 8:106617425-106617447 TCTCAAAAAAAAAGGGGGGTGGG + Intronic
1046159427 8:110341059-110341081 CTTAAAAAACTGAGGGATGTTGG - Intergenic
1047812108 8:128422135-128422157 CCTGTAAAAAAGAGGGAGGCAGG + Intergenic
1048618778 8:136108863-136108885 TATCAGAAACAGAGGGTGGTGGG - Intergenic
1050382391 9:5042973-5042995 CCTCAGAAGCTGAGGGGGGTGGG + Intronic
1051569277 9:18537497-18537519 AATCAAAACCAGAGGTAGGTGGG + Intronic
1051658682 9:19407180-19407202 TCTCAAAAACGAAGGGCGGTTGG - Intergenic
1053048616 9:34940070-34940092 GCTCAGGCACAGAGGGAGGTGGG + Intergenic
1054453704 9:65418381-65418403 AGTCAAGAACAGAGGCAGGTTGG + Intergenic
1054862853 9:69971100-69971122 TCTCAAAATCAAAGGTAGGTTGG - Intergenic
1056255479 9:84795152-84795174 CTCCAAAGACAGAGGGAAGTGGG + Intronic
1056756490 9:89385174-89385196 CCTCAAAGGCAGAAGGGGGTAGG - Intronic
1058079269 9:100685276-100685298 CCTCAAGGAGAGAAGGAGGTTGG + Intergenic
1059938942 9:119338913-119338935 CAACAAAAACACAGGGGGGTGGG + Intronic
1060742265 9:126107066-126107088 CCTGAAAAAGACATGGAGGTGGG + Intergenic
1060964728 9:127706232-127706254 GGTCAGAAACACAGGGAGGTGGG - Intronic
1186662639 X:11684643-11684665 CCTCAATAACTGAAGGAGATGGG - Intergenic
1187437218 X:19283642-19283664 CATCAACAAGACAGGGAGGTGGG + Intergenic
1187951542 X:24475655-24475677 TCTCAAAAAAAGAAGGAGGGAGG + Intronic
1189201477 X:39199659-39199681 CCTCATAAACAGAGGAAGTCAGG - Intergenic
1189385831 X:40536173-40536195 TCTCAAAAAAAGGTGGAGGTGGG + Intergenic
1189921100 X:45903992-45904014 CCACAAAAACAGAGGGAGAAGGG + Intergenic
1190394925 X:49972350-49972372 ACACAAAAACAGAGGGAGGAAGG - Intronic
1190636307 X:52437423-52437445 AATCATAAACAGAGGGAGGCTGG + Intergenic
1190948725 X:55121192-55121214 GCTCAGACACAGAAGGAGGTGGG - Intronic
1190962374 X:55265155-55265177 CCTCATAAATAGAGGGAAGAGGG + Intronic
1191749740 X:64528909-64528931 CCTCAAATGCATAGTGAGGTAGG - Intergenic
1192553327 X:72070681-72070703 CCACCAAGACAGAGGGAGGAGGG - Intergenic
1194316020 X:92379108-92379130 CCTCCAATTCAGAAGGAGGTGGG - Intronic
1195275376 X:103276027-103276049 GCTCCAAAATGGAGGGAGGTTGG + Intronic
1196018695 X:110966426-110966448 ACTCAAAAAAGGAGGGAGGGAGG + Intronic
1197604642 X:128571040-128571062 CTTCAAATACAGATGGATGTGGG - Intergenic
1197782618 X:130172497-130172519 CCTAAAAAACTGAGTGAAGTGGG - Intronic
1198373592 X:136015543-136015565 CCACAAAAACTCAGTGAGGTAGG - Intronic
1200144700 X:153920634-153920656 CCTCAAGAAGGGAGGGAGGCTGG - Exonic
1201379207 Y:13354394-13354416 TCTCAAAAAAAAAGGGAGGCAGG + Intronic
1201394439 Y:13533345-13533367 CCTCATAAAATGAGGTAGGTAGG + Intergenic