ID: 1140742133

View in Genome Browser
Species Human (GRCh38)
Location 16:77951083-77951105
Sequence CTGTATTTCCTTCAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140742133_1140742137 -3 Left 1140742133 16:77951083-77951105 CCATCCACCTGAAGGAAATACAG 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1140742137 16:77951103-77951125 CAGAGAATGGAAAGATACGTTGG 0: 1
1: 0
2: 0
3: 17
4: 242
1140742133_1140742138 6 Left 1140742133 16:77951083-77951105 CCATCCACCTGAAGGAAATACAG 0: 1
1: 0
2: 0
3: 17
4: 197
Right 1140742138 16:77951112-77951134 GAAAGATACGTTGGCTGCACTGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140742133 Original CRISPR CTGTATTTCCTTCAGGTGGA TGG (reversed) Intronic
900711865 1:4119544-4119566 TTGTCTGTCCTTCCGGTGGATGG - Intergenic
901238400 1:7679635-7679657 CTGTGTATCCTGCAGGTGCAGGG - Intronic
901962254 1:12836755-12836777 CTGGATTTCCTTCATGTTTACGG - Intergenic
902256636 1:15193305-15193327 CTGTAGTTCCTGCAGTGGGATGG + Intronic
902321244 1:15668221-15668243 CTGTATTTCCTTCCCGAGGCAGG + Exonic
903143532 1:21355129-21355151 CTGTAGTTCTTTCATGTGGAGGG + Intergenic
905945576 1:41898761-41898783 CTCTACTTGCTTCAGCTGGAAGG - Intronic
906658956 1:47568982-47569004 CAGTATTTCCACCATGTGGATGG - Intergenic
906995678 1:50791400-50791422 CTGTATTTTCTTCTGCTAGATGG + Intronic
909420508 1:75459564-75459586 CTGTATTTCCTTCTCGGGAAAGG - Intronic
910840355 1:91555268-91555290 CTCTATTGCCGTCAGGAGGAGGG + Intergenic
912050184 1:105519836-105519858 CTGTATTTCCTTCAGGAATGTGG + Intergenic
913060339 1:115198808-115198830 CTGGATTTTTTTCAGGTGGCAGG - Intergenic
916157011 1:161862106-161862128 CTGTATTTCCCCCAGGAGGATGG + Intronic
917562828 1:176177756-176177778 TTGTATTTTGTTAAGGTGGAGGG - Intronic
921837158 1:219790131-219790153 CTGGATATGCTTCAAGTGGAAGG - Intronic
923315550 1:232776657-232776679 GTGTATTTCCTTTAAGTGAATGG + Intergenic
1063023966 10:2159040-2159062 GTGTATGACCTACAGGTGGAAGG + Intergenic
1063700751 10:8382864-8382886 GTGTGGTTCCTTCAGGTGGATGG + Intergenic
1063739598 10:8803695-8803717 CTGTATTTTCTTCAGGTATTAGG + Intergenic
1066278009 10:33887654-33887676 CTGGATTGCGTGCAGGTGGAAGG - Intergenic
1067132521 10:43577521-43577543 CTGTAATTCCCACAAGTGGAGGG + Intergenic
1067302570 10:45025797-45025819 CTTTATTTCCTTCTCGTGGTTGG + Intergenic
1070832526 10:79427953-79427975 TTCTAGTTTCTTCAGGTGGAAGG - Intronic
1071201368 10:83223009-83223031 CTCTTTTTCTTTCAGGTGAAAGG - Intergenic
1071392545 10:85190159-85190181 CTGTATTTCCTTTGGGTTGGGGG + Intergenic
1073523807 10:104160526-104160548 CAGTGTTTCCTTCTGATGGATGG + Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075501983 10:122983365-122983387 CTTTCTTCCCATCAGGTGGATGG - Exonic
1077949152 11:6936088-6936110 TTCTAGTTCCTTCAGGTGGAGGG - Intronic
1078459012 11:11499259-11499281 CAGTATTTCCATCAGCTGGCAGG + Intronic
1078525202 11:12095556-12095578 GTGAATTTCATTCAGGTGGCTGG - Intronic
1080662614 11:34309956-34309978 CTGTATTAACTTCAGGTGTCAGG + Intronic
1081179214 11:39966532-39966554 CTTTCTTTCCTTCAGGTAAATGG + Intergenic
1085077776 11:73606995-73607017 CTGAGTTTCCTCCAGCTGGAAGG + Intergenic
1086448137 11:86889498-86889520 CTGTATTCCCACAAGGTGGAAGG + Intronic
1087133301 11:94688560-94688582 TTCTAGTTCCTTCAGGTGTAAGG - Intergenic
1088031797 11:105260413-105260435 AAGTATTTTCTTCAGGAGGAGGG - Intergenic
1090095234 11:123736286-123736308 CTGTCTCTCCTTTAGGTTGATGG - Intronic
1093206046 12:16251267-16251289 CTCTAGTTCCTTGAGGTGTAAGG - Intronic
1093557823 12:20498276-20498298 CTACATTTCCTTCAGTTGGGGGG - Intronic
1093994520 12:25627472-25627494 CTGAATGTCCTTCAGGTGCTGGG + Intronic
1096352903 12:50915283-50915305 CTGCATTGCCATCAGGTGGTGGG + Intergenic
1101178788 12:102187507-102187529 GTGTATTTCAATCAAGTGGAAGG - Intronic
1101598830 12:106190692-106190714 CTATATTTTTTTCAGGTGAAAGG - Intergenic
1103857642 12:123984516-123984538 CTGTTTTTCCTTAAGGTTGGGGG + Intronic
1107829737 13:44363757-44363779 ATGTGTTTCCTTCAGCTTGATGG - Intergenic
1107852827 13:44588197-44588219 ATATATTTCCTTCAGGTTAAAGG + Intergenic
1108732682 13:53251296-53251318 GTGTATTTCCTGCAGGAGGTGGG - Intergenic
1114190463 14:20436315-20436337 CTGTATGACCTACAGGTGGAAGG - Intergenic
1115023388 14:28711050-28711072 TTCTAGTTCCTTCAGGTGCAAGG - Intergenic
1116237788 14:42302182-42302204 CTTTATTTCCTTCACCTGGTGGG - Intergenic
1116505902 14:45681051-45681073 CTGCTTTTACTTAAGGTGGAAGG + Intergenic
1116596334 14:46851718-46851740 ATGTATTTACTTCAAGTGGACGG - Intronic
1117648935 14:57882183-57882205 CTGTAGTTTCTCCAGGGGGAAGG - Intronic
1118807878 14:69253526-69253548 CTGCATTTCCTTCAGTTTAATGG - Intergenic
1120157084 14:81105325-81105347 CTGTCTTGACTTCAGATGGAAGG + Intronic
1122036822 14:98954990-98955012 CTGTCTTTTCTTGAGGAGGAGGG - Intergenic
1122806113 14:104258857-104258879 AAGAAATTCCTTCAGGTGGAAGG + Intergenic
1122928102 14:104918940-104918962 CATTATTTCCTTCCAGTGGAGGG - Intergenic
1123154318 14:106209838-106209860 CTGTGCTCCCTGCAGGTGGAGGG - Intergenic
1123929171 15:25151458-25151480 CTGTATTTTTCTAAGGTGGAAGG - Intergenic
1124137655 15:27048924-27048946 CTGACTTTCCTTCAGGTGTTTGG + Intronic
1126563990 15:50075711-50075733 AGGTGTTTCCTTCAGGTGGGTGG - Intronic
1127627105 15:60790436-60790458 CTGTATTTCCTTCAAGAAGCTGG + Intronic
1127827266 15:62715669-62715691 CTCTTTTTCTGTCAGGTGGACGG + Intronic
1130243802 15:82223990-82224012 CTGTTTGTCCTTCAGGGGAAAGG - Intronic
1130456674 15:84117294-84117316 CTGTTTGTCCTTCAGGGGAAAGG + Intergenic
1132771481 16:1565962-1565984 GTCTCTGTCCTTCAGGTGGAAGG - Intronic
1137352781 16:47728421-47728443 CTGTGTTTCCTTCCTGTTGAAGG + Intergenic
1137709029 16:50553883-50553905 CTGTCTTTCCTCCTGGGGGATGG + Intronic
1140163013 16:72518500-72518522 ATGTATGTTCTTCACGTGGATGG - Intergenic
1140742133 16:77951083-77951105 CTGTATTTCCTTCAGGTGGATGG - Intronic
1142038157 16:87875320-87875342 ATGCATTTGCTTCAGGTGGGCGG + Intergenic
1143014045 17:3882441-3882463 ATGTATGACCTTCAGGTGGGCGG - Intronic
1144957824 17:19028274-19028296 CAGTATTTCCTCCAACTGGAAGG + Intronic
1144977334 17:19146246-19146268 CAGTATTTCCTCCAACTGGAAGG - Intronic
1147190181 17:38733869-38733891 CTGTAGTTCTTTGGGGTGGAGGG - Exonic
1148570099 17:48661468-48661490 CTGGATGTACTTCAGGGGGAGGG + Intergenic
1151398436 17:73840314-73840336 CTTTCTTTCTTCCAGGTGGAGGG + Intergenic
1153092498 18:1363926-1363948 CTGTATTTCCTTCCTGTGCGAGG - Intergenic
1155668130 18:28335955-28335977 CTGTATTCCCTCCAGGTGGCAGG + Intergenic
1156395698 18:36697919-36697941 CTGAGTCTCCTTCAGGTGTAGGG + Intronic
1158041676 18:53101925-53101947 CTGTAATTACTTCAGGAGTAGGG + Intronic
1161740834 19:6020199-6020221 CAGTATGTCCTCCTGGTGGATGG - Intronic
1163229321 19:15989477-15989499 CTGTATTTCATTCTGTTTGATGG + Intergenic
1163415761 19:17185660-17185682 TTGTTTTTGCCTCAGGTGGAAGG - Intronic
1163841339 19:19612582-19612604 CTGTATTTCCTCCAGAGGGGTGG + Intronic
1165121931 19:33565470-33565492 CTGTCTTTTCTTCAGGGGGCTGG - Intergenic
1166202671 19:41248673-41248695 CTGTATTTCCTATAGTTGGGTGG - Intronic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
926712992 2:15898060-15898082 CTATATTTGTTTCAGGTGGGAGG - Intergenic
928708511 2:33978236-33978258 CTGTATTACTTTTAGGTAGAGGG + Intergenic
928747044 2:34427542-34427564 ATGTACTTCCTTCAGATGGCTGG - Intergenic
930441507 2:51413720-51413742 CTGTGTTGACTTCAGATGGAGGG + Intergenic
930799372 2:55426789-55426811 TTTTATTTCCTTCTGGTGAATGG + Intergenic
930856543 2:56025070-56025092 CTGTATTACCTTCCTTTGGATGG - Intergenic
930953571 2:57175729-57175751 CTTTATTTTCTGCAGCTGGAAGG - Intergenic
931823308 2:65973983-65974005 CTGTATTTCCTTCTGATGTAAGG - Intergenic
933907734 2:86912249-86912271 CTGCATTCCAGTCAGGTGGAAGG + Intronic
933908982 2:86921964-86921986 CTGCATTCCAGTCAGGTGGAAGG + Intronic
934023742 2:87981421-87981443 CTGCATTCCAGTCAGGTGGAAGG - Intergenic
935566667 2:104616017-104616039 CTGGAATTTCATCAGGTGGAAGG + Intergenic
935814372 2:106832781-106832803 TTGTATTTTCTTCTGGGGGAGGG + Intronic
935819532 2:106880734-106880756 ATGTTCTTCCTTCAGTTGGAAGG + Intronic
936364395 2:111839144-111839166 CTGCATTCCAGTCAGGTGGAAGG - Intronic
938315493 2:130324148-130324170 CTGTATTTCCTTGGGGTTGGTGG + Intergenic
940645014 2:156382225-156382247 CAGTCTTTCTTTCAGGTAGAAGG - Intergenic
942565526 2:177262351-177262373 CAGTATCTCCATTAGGTGGAAGG - Intronic
942643171 2:178082338-178082360 TTGTATTTCTTTCAGGTGTATGG - Intronic
942771143 2:179521908-179521930 CTGTATTTCCTTAAGGTTTCTGG + Intronic
942835989 2:180298950-180298972 CTCTAGTTTCTTAAGGTGGAAGG + Intergenic
943124935 2:183784357-183784379 CTATATATACTTCAGGAGGAAGG - Intergenic
944373691 2:199014676-199014698 CTGTATTTGGTCCATGTGGATGG - Intergenic
945388777 2:209237928-209237950 CTGTATTTTTCTCAAGTGGATGG + Intergenic
945460757 2:210105222-210105244 CTGTATTATTTTCAGGAGGAAGG - Intronic
947145025 2:227056396-227056418 TTGTATTTCCTCTTGGTGGAGGG + Intronic
1169731085 20:8786147-8786169 CTGTAACTCCTTCAAGTGGTTGG + Intronic
1169937719 20:10902654-10902676 CTATTTTTCCTTCAGTTGGAAGG + Intergenic
1170603270 20:17858015-17858037 CAGTATTTCCTTCAGCTTAACGG - Intergenic
1170747624 20:19114808-19114830 CAGTATTTTATTCAGGTGAATGG - Intergenic
1171090904 20:22285096-22285118 CAGTATTTCCTTCATGAGGGAGG + Intergenic
1171560312 20:26118746-26118768 CTGCAACTGCTTCAGGTGGAAGG + Intergenic
1174619116 20:51860567-51860589 CTGTTTTTCCTTCAGATGTTTGG + Intergenic
1177969860 21:27776618-27776640 TAATACTTCCTTCAGGTGGAAGG - Intergenic
1181960189 22:26617131-26617153 ATGTATTTACTGCATGTGGAGGG + Intronic
1182925613 22:34121253-34121275 CTGTATTGCATTCAGGTGGGGGG + Intergenic
1183232922 22:36594040-36594062 TTGTATTTCCTTCTGGTTGGTGG + Intronic
1184588942 22:45467988-45468010 CTGTAATTCCCACATGTGGAGGG - Intergenic
950602376 3:14045970-14045992 CTGCATTTGCTTGAGGGGGAGGG + Intronic
950603013 3:14051826-14051848 CTGAATTTCCTTCAGAAGAAAGG - Intronic
951252884 3:20415061-20415083 CAGTCTTTGCTTCAGATGGAGGG + Intergenic
951365923 3:21782336-21782358 CTGAATTTCCTCCAGGTAGCAGG - Intronic
953584347 3:44186348-44186370 CTTTCTGTCCTTCAGGTGGCTGG - Intergenic
954566402 3:51603779-51603801 CTGTAATTCCATCACTTGGAAGG - Intronic
954576892 3:51681230-51681252 CTGCCTTTTCTCCAGGTGGAGGG + Intronic
956087003 3:65622081-65622103 ATGTATTTCCTGCAGGAGGAAGG - Exonic
956208583 3:66779515-66779537 TTGTATTACTTCCAGGTGGAGGG + Intergenic
959078632 3:101777824-101777846 CTGTATTTCCTCGAGGAAGAAGG + Intergenic
960079225 3:113523353-113523375 CTGTATTTCCTCCAGGGCGGAGG + Intergenic
960719330 3:120610432-120610454 CTGAATTTCCTGGAGCTGGATGG + Intergenic
962187741 3:133277846-133277868 TTGTATTTTCATCAGGTGCAAGG + Intronic
962602877 3:137008038-137008060 CTGTATTTGCTTCATGGGAATGG + Intronic
963317037 3:143770873-143770895 TTGTATTTCCTTTTGGTGCATGG - Intronic
966520625 3:180869969-180869991 CTCTCTTTCCTTTAGGTGAAAGG - Intronic
969355254 4:6621233-6621255 CCGGATTTCCTTTGGGTGGACGG - Exonic
971516810 4:27497437-27497459 CTGTATTTCCTGAATGTGCATGG - Intergenic
975295203 4:72726596-72726618 CTCTTTTTTCTTCAGGTAGAAGG - Intergenic
976211013 4:82669720-82669742 TTGTATTTCCACCAGGAGGAGGG + Intronic
978051008 4:104200143-104200165 CTGTACTTCCTTTAGTTGGTAGG + Intergenic
980283771 4:130756200-130756222 CTCTCTTTTCTCCAGGTGGATGG + Intergenic
982911650 4:161149364-161149386 CTGTGTTTACTTAAGGTGCAAGG - Intergenic
984466009 4:180101068-180101090 CTGTGTTTCCCTGGGGTGGATGG - Intergenic
985250114 4:188015700-188015722 CTGTAATACCTTCAGGGGGCTGG - Intergenic
986387882 5:7254584-7254606 CTGTGTTTCTTTCAGGTTGTAGG + Intergenic
988033704 5:25798191-25798213 CTGCAATTCCGTCAGGAGGAAGG - Intergenic
990190505 5:53254722-53254744 CTGTCTTTTCATCAAGTGGATGG - Intergenic
991416007 5:66393616-66393638 CTGTCTTTCCATCATGTGGAAGG + Intergenic
992419334 5:76586519-76586541 TTGTATTTCCTTATGGTGGTTGG - Intronic
992511307 5:77438338-77438360 ATGTATTTGCTGCAGTTGGAAGG - Exonic
992822283 5:80509405-80509427 CTGCATTTTCATCTGGTGGAAGG - Intronic
993936420 5:94010111-94010133 ATGTAATTTCTTAAGGTGGAAGG + Intronic
994328142 5:98473411-98473433 TTGTATTTCCTGCAGGAGGCTGG + Intergenic
995179615 5:109218774-109218796 AAGTATTTTCCTCAGGTGGATGG + Intergenic
995563281 5:113406280-113406302 ATGTCTTTCCTTCAGCTGGAAGG - Intronic
998909822 5:146947001-146947023 CTGTCTTTCCTTCAGTTGTGAGG - Intronic
1000107664 5:158075766-158075788 CTTTATTTTCTTCAGTTGGCTGG - Intergenic
1000364696 5:160479883-160479905 CTGGTTTTCCTTCATGTGAAAGG + Intergenic
1002167245 5:177355848-177355870 CTCTTTCTCCTTCAGCTGGATGG - Intergenic
1002326087 5:178407292-178407314 CTTCATTACTTTCAGGTGGAGGG - Intronic
1003732288 6:8838731-8838753 TTGTATTTCATTAAGATGGATGG + Intergenic
1005490621 6:26344029-26344051 CTCTGTCTCCTTCAGGAGGAGGG - Intergenic
1008163031 6:48102084-48102106 CTGTATTCCCTGCAGTTAGAAGG - Intergenic
1011640130 6:89411047-89411069 CTGCATTTTCTTAAGGTGTAAGG - Intronic
1011802061 6:91028260-91028282 CTGTATTTTTTCCAGGTGGGTGG + Intergenic
1012263138 6:97111203-97111225 CTCTCTTTCCTGCAGGTGAAAGG - Intronic
1013429424 6:110042620-110042642 CTGTTTTTCCTTCAGGGTGAGGG - Intergenic
1014661085 6:124172558-124172580 CTGTATATCATTCTTGTGGAAGG + Intronic
1016700930 6:147053458-147053480 CTGAAATTCTTTCAGGTGAAAGG - Intergenic
1018089763 6:160335646-160335668 TTGTCTTTCCTTCAGGTGCCCGG - Intergenic
1019042397 6:169118042-169118064 CTCTGTTTCTTTCAGGTGAAAGG + Intergenic
1019152088 6:170013864-170013886 TTGTATTTCCATTACGTGGAAGG - Intergenic
1021185425 7:17558793-17558815 TTGTATATCCTTCAGGTTTATGG - Intergenic
1022684750 7:32586338-32586360 CTATATTTCCTTCAGGTTCTGGG + Exonic
1024440522 7:49411223-49411245 CTTTATTTTCTTAATGTGGAAGG - Intergenic
1024658940 7:51475142-51475164 GGGTATTTCTTTTAGGTGGAAGG + Intergenic
1027479273 7:78674326-78674348 CAATATTTCTTTGAGGTGGAAGG + Intronic
1029218747 7:98970978-98971000 CTGTATCTCCTTAAGGTCGTTGG + Intronic
1029892112 7:103941278-103941300 CTGTGTTTCCTTTAAGTGGTAGG + Intronic
1033028053 7:137796124-137796146 CTGTTTTTCCTTCATGTGTATGG - Intronic
1037991186 8:23322250-23322272 CTGGATCTCGTTGAGGTGGATGG + Exonic
1038083434 8:24166041-24166063 CAGTTTTTCCTGAAGGTGGAGGG + Intergenic
1040300132 8:46183656-46183678 CTCTATGTCCCTCTGGTGGAAGG + Intergenic
1043865110 8:85365734-85365756 TTGTATTTTCTTCATGTGTATGG - Intronic
1045828372 8:106428290-106428312 CTGTATTTTCTACAGGAAGAAGG + Intronic
1049269034 8:141684359-141684381 TTGTGCTTCCTTCATGTGGAGGG + Intergenic
1049831696 8:144705020-144705042 CTGCATTTCCTTCAGCATGAAGG - Intergenic
1049965845 9:778664-778686 TTGTAGTTCCTTGAGGTGCATGG - Intergenic
1051706136 9:19882098-19882120 CTCTATTTCCTTGGGGTAGAGGG + Intergenic
1055032966 9:71789400-71789422 CTGTAATTCCTGCAGGTGGCAGG + Intronic
1057713769 9:97471152-97471174 CTCTGTTTCCTTTAGGAGGAAGG - Intronic
1058573198 9:106370559-106370581 GTCTCTTTCCTTCATGTGGAGGG + Intergenic
1060285393 9:122247229-122247251 CTGTCATTTCTTCGGGTGGAGGG - Intronic
1062140088 9:134951261-134951283 CTGCATTTCCTTCAGCAGAAGGG + Intergenic
1185642853 X:1598009-1598031 CTGCATTTCTTTCTGGTGGGTGG + Intronic
1186051945 X:5605605-5605627 CTGTATTTTCTTCAGTTCAATGG - Intergenic
1186614405 X:11171664-11171686 TTGTCTTTCTTTCAGGTGAACGG + Intronic
1187179279 X:16928284-16928306 CTGTATTTCCTGCACTTTGATGG + Intergenic
1188379093 X:29469372-29469394 CTGGATTTCCTTAATATGGATGG - Intronic
1189375139 X:40460666-40460688 CTGTATCTCCATCTGGTTGATGG + Intergenic
1190594674 X:52041146-52041168 ATGTGGTTCCTTCTGGTGGAGGG + Intergenic
1190614150 X:52212927-52212949 ATGTGGTTCCTTCTGGTGGAGGG - Intergenic
1194931567 X:99894357-99894379 CTGTATTTCATTCCAGTGTAAGG + Intergenic
1198434611 X:136604221-136604243 CTACATTTCCTTAAGGTAGAAGG - Intergenic
1199107413 X:143886798-143886820 CTGTGTTTTCTTCAGATTGATGG + Intergenic