ID: 1140743272

View in Genome Browser
Species Human (GRCh38)
Location 16:77960437-77960459
Sequence GTGCCCCTTCAGGCCCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 1, 2: 6, 3: 28, 4: 350}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140743272_1140743277 -10 Left 1140743272 16:77960437-77960459 CCACCCTGGGCCTGAAGGGGCAC 0: 1
1: 1
2: 6
3: 28
4: 350
Right 1140743277 16:77960450-77960472 GAAGGGGCACGAGGAAGCAAAGG 0: 1
1: 0
2: 1
3: 39
4: 417
1140743272_1140743279 29 Left 1140743272 16:77960437-77960459 CCACCCTGGGCCTGAAGGGGCAC 0: 1
1: 1
2: 6
3: 28
4: 350
Right 1140743279 16:77960489-77960511 AGAGAAAGCTAGGACCTTGCAGG 0: 1
1: 0
2: 3
3: 8
4: 142
1140743272_1140743278 19 Left 1140743272 16:77960437-77960459 CCACCCTGGGCCTGAAGGGGCAC 0: 1
1: 1
2: 6
3: 28
4: 350
Right 1140743278 16:77960479-77960501 CAGATTGCACAGAGAAAGCTAGG 0: 1
1: 0
2: 1
3: 16
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140743272 Original CRISPR GTGCCCCTTCAGGCCCAGGG TGG (reversed) Intronic