ID: 1140743272

View in Genome Browser
Species Human (GRCh38)
Location 16:77960437-77960459
Sequence GTGCCCCTTCAGGCCCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 1, 2: 6, 3: 28, 4: 350}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140743272_1140743279 29 Left 1140743272 16:77960437-77960459 CCACCCTGGGCCTGAAGGGGCAC 0: 1
1: 1
2: 6
3: 28
4: 350
Right 1140743279 16:77960489-77960511 AGAGAAAGCTAGGACCTTGCAGG 0: 1
1: 0
2: 3
3: 8
4: 142
1140743272_1140743277 -10 Left 1140743272 16:77960437-77960459 CCACCCTGGGCCTGAAGGGGCAC 0: 1
1: 1
2: 6
3: 28
4: 350
Right 1140743277 16:77960450-77960472 GAAGGGGCACGAGGAAGCAAAGG 0: 1
1: 0
2: 1
3: 39
4: 417
1140743272_1140743278 19 Left 1140743272 16:77960437-77960459 CCACCCTGGGCCTGAAGGGGCAC 0: 1
1: 1
2: 6
3: 28
4: 350
Right 1140743278 16:77960479-77960501 CAGATTGCACAGAGAAAGCTAGG 0: 1
1: 0
2: 1
3: 16
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140743272 Original CRISPR GTGCCCCTTCAGGCCCAGGG TGG (reversed) Intronic
900126208 1:1069937-1069959 CGGCCCCATCAGGCACAGGGTGG + Intergenic
900668976 1:3837824-3837846 GTGCCCCTGCAGGAGCACGGTGG + Intronic
901815284 1:11790165-11790187 GTGCCCCTTCAGTCACAAGTAGG + Exonic
902408938 1:16201809-16201831 GTGCCCCTCCAGCCCCCAGGAGG - Exonic
902569208 1:17336082-17336104 CTGCCCATTCAGGGCCAGGCTGG + Intronic
902682710 1:18054942-18054964 GTGCCCATTCATGGCCAGTGGGG + Intergenic
903670701 1:25033901-25033923 GAGTCCCTTGAGCCCCAGGGAGG + Intergenic
903978861 1:27170783-27170805 TTGCCTCTTCAGGCCTGGGGTGG - Intergenic
904627417 1:31814835-31814857 GAGCTGCCTCAGGCCCAGGGAGG - Exonic
904858047 1:33514755-33514777 CTCTCCCTCCAGGCCCAGGGGGG + Exonic
904987593 1:34564658-34564680 GTGCCCTTTCAAGCCCGGGAAGG - Intergenic
905252576 1:36659026-36659048 TTGCTCCTTCAGCCCCAGGGTGG + Intergenic
905358683 1:37403253-37403275 GAGCCCTGTTAGGCCCAGGGAGG - Intergenic
905863643 1:41365649-41365671 GTTCCCCTCCAGGCCTAGGATGG + Intronic
906154022 1:43603599-43603621 GTGGTCCTTCAGTCCCAGGCCGG + Exonic
907261669 1:53222803-53222825 GGTTCCCTTCTGGCCCAGGGTGG - Intergenic
907943746 1:59113475-59113497 CTGCCCCAGCAGGCCAAGGGTGG + Intergenic
908797699 1:67847303-67847325 TTACCTCTTCAGGCCTAGGGTGG + Intergenic
908831427 1:68182579-68182601 GTGCCCCTTCAAACCAAGGCTGG - Intronic
911474147 1:98355750-98355772 CTGCCCCTGCAGACGCAGGGAGG - Intergenic
913931755 1:124976232-124976254 GTGCCCTTTGAGGCCTATGGTGG - Intergenic
915129738 1:153688098-153688120 GTGACTCTGCAGGGCCAGGGAGG - Exonic
915311539 1:155008028-155008050 GTTGCCCCTCAGGCCCAGGCGGG + Intronic
915518768 1:156429349-156429371 GTGCCCATTCGGGTCCAGGGAGG - Intronic
919077990 1:192835928-192835950 CTTCACCTTCAGGACCAGGGAGG - Intergenic
919712188 1:200739305-200739327 GAGACCCCTCAGGCCCCGGGTGG - Intergenic
920021282 1:202958283-202958305 GCGCCCCTTCCGGCGCGGGGAGG - Exonic
920420619 1:205830768-205830790 GTTCCCCATGACGCCCAGGGTGG + Intronic
920420633 1:205830832-205830854 GTTCCCCATGACGCCCAGGGTGG + Intronic
922257031 1:223901170-223901192 CTGCCCATTGAGGCCCAGAGGGG - Intergenic
923847517 1:237752279-237752301 GTGCACCTGTAGGCCCAGGTGGG - Intronic
924064159 1:240207119-240207141 GTCCACTTTCAGCCCCAGGGGGG - Exonic
924338223 1:243003977-243003999 CTGCCCATTGAGGCCCAGAGGGG - Intergenic
924477696 1:244395914-244395936 GTGCAGCCTCAGGCTCAGGGTGG + Intergenic
1064256609 10:13747753-13747775 GTGCTCCTTCAGGGCTTGGGTGG + Exonic
1064673273 10:17737126-17737148 TTGCTCCTTTGGGCCCAGGGTGG - Intergenic
1066022106 10:31314227-31314249 TTGTGTCTTCAGGCCCAGGGTGG - Intergenic
1071017516 10:81015541-81015563 GTCCGCCTTCAGGACAAGGGTGG + Intergenic
1072050722 10:91700550-91700572 CTGCCCCTGCAGGCCGAGGAAGG + Intergenic
1072492250 10:95919751-95919773 GGTTCCCTTCTGGCCCAGGGTGG + Intronic
1075737275 10:124671631-124671653 GTGGCCCTTCAGGGAGAGGGTGG + Intronic
1076461229 10:130648936-130648958 CTGCCCATTCAGGCCTAGGGTGG + Intergenic
1076483165 10:130798077-130798099 GCGCGCCTTCACTCCCAGGGAGG + Intergenic
1076634942 10:131875832-131875854 AAGCCCCTTCAGGCCCTGCGTGG - Intergenic
1076634992 10:131876044-131876066 TTGTCTCTTCAGGCCCAGAGAGG + Intergenic
1077075244 11:697989-698011 TTTCCCCTTCAGCGCCAGGGAGG - Intronic
1077196451 11:1283299-1283321 GGACCCCTCCAGGCCAAGGGAGG + Intronic
1077324066 11:1956108-1956130 CTGCCCCAGGAGGCCCAGGGAGG + Intronic
1078821909 11:14891642-14891664 CCGCCACTTCAGGTCCAGGGTGG - Intronic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1080570746 11:33554676-33554698 GTGCCCTTTCTGGGCCAAGGAGG + Intronic
1081055082 11:38399862-38399884 GTGCCCATTCAGGTTGAGGGTGG - Intergenic
1083640369 11:64142100-64142122 CAGCCCCTTCAGGCCTAGAGGGG + Intronic
1083707908 11:64529407-64529429 GTTCCCCTCCAGTCCCTGGGAGG - Intergenic
1084161621 11:67353382-67353404 GAGCCGCTTCCGGCCCATGGCGG + Exonic
1084731543 11:71076746-71076768 GTGCCTCTGCAGGAGCAGGGTGG - Intronic
1085443999 11:76588836-76588858 GTGGGTCTCCAGGCCCAGGGAGG - Intergenic
1088354871 11:108932363-108932385 GTGCACCTTTAGTCCCAGGGAGG + Intronic
1088459868 11:110071208-110071230 GTGTCCCTTCACTCCCAGGCTGG + Intergenic
1089646880 11:119886344-119886366 TTGCCCCTCCAGGCCCACGGTGG + Intergenic
1091069318 11:132548406-132548428 GTGACCCTCCTGGCCCTGGGAGG + Intronic
1202807052 11_KI270721v1_random:11303-11325 CTGCCCCAGGAGGCCCAGGGAGG + Intergenic
1094847056 12:34365961-34365983 GTGGCGCCTCAGGCCCACGGGGG - Intergenic
1096531026 12:52243015-52243037 GAGACCCTCCAGGCCCAGGCTGG + Exonic
1098959102 12:76719676-76719698 GGTTCCCTTCTGGCCCAGGGTGG - Intergenic
1098975336 12:76896291-76896313 GATTCCCTTCTGGCCCAGGGTGG - Intergenic
1100371728 12:93974967-93974989 TTGCTCCTTCAGGCCTAGGGTGG - Intergenic
1101438999 12:104688923-104688945 TTGCCCCTTCTTGCCCAGGCTGG - Intronic
1101922285 12:108942695-108942717 TTGCCCCTTCTGGCCTGGGGTGG + Intronic
1102060970 12:109930812-109930834 CTGCCCCTGCTGTCCCAGGGAGG - Exonic
1102299015 12:111757860-111757882 GTGCTCCCTCAGGCTCCGGGAGG + Intronic
1103392459 12:120584546-120584568 CGGCCCCTTCTGGCCCAGGAGGG + Intergenic
1103929151 12:124440060-124440082 GTGGCCCCCCAGGCCCTGGGAGG - Intronic
1104363459 12:128155120-128155142 TTGCCCCTCCAGGCCAGGGGAGG + Intergenic
1104654923 12:130567494-130567516 GTGTCCCTTCAGGCAGAGTGGGG - Intronic
1104980244 12:132570349-132570371 GTGCTTCCCCAGGCCCAGGGGGG - Exonic
1105090514 13:16280824-16280846 GAGCCCTTTCAGGCCTATGGTGG + Intergenic
1105415646 13:20209054-20209076 TTGCCCCTTCAGCCACAGGAGGG + Intergenic
1107105181 13:36635711-36635733 CCTCCCCTTCAGGCCAAGGGTGG - Intergenic
1107582214 13:41802730-41802752 GGTTCCCTTCTGGCCCAGGGTGG - Intronic
1108206495 13:48095202-48095224 GTGCGCCTCCAGGCCCAAAGGGG - Intergenic
1109402860 13:61857788-61857810 GTTTCCCTTCTGACCCAGGGCGG + Intergenic
1113746298 13:112747223-112747245 GTGCAGCCTCAGGGCCAGGGTGG + Intronic
1113848019 13:113403536-113403558 GGGCCCTCTCAGCCCCAGGGTGG + Intergenic
1117951125 14:61083341-61083363 TTGCCCCTTCAGTCATAGGGTGG + Intronic
1118287314 14:64487643-64487665 GTGCTCCTCCAGGGCCTGGGTGG + Exonic
1118549351 14:66932491-66932513 GGTCCCCTTCTGGCCCAAGGTGG + Intronic
1118947651 14:70402574-70402596 GTGCACCTGTAGTCCCAGGGAGG + Intronic
1119844453 14:77818026-77818048 CTACCCCTTGAGGCCCAGCGTGG - Intronic
1122163991 14:99807533-99807555 CTGCCCCTTCAGGCCTAGGGTGG - Intronic
1122324619 14:100874954-100874976 GTGCCCCTTTGTGCCCAGGGTGG + Intergenic
1122374516 14:101249066-101249088 CTGCCTCTTCTGGCACAGGGCGG + Intergenic
1123068992 14:105632062-105632084 CTGCCCCCTCTGGCCCAGGTGGG + Intergenic
1123387643 15:19831833-19831855 GTGCCCTTTGAGGCCTATGGTGG - Intergenic
1124646827 15:31442818-31442840 GTCCCCCTGCAGGCACAGGGTGG - Intergenic
1126875234 15:53034074-53034096 GTGCCCTGACAGTCCCAGGGAGG - Intergenic
1127259259 15:57316544-57316566 GTGCCACTTCAGGCCCAGGAAGG - Intergenic
1128563123 15:68681671-68681693 GTGCCCCTCGAGGGCCAGGCAGG + Intronic
1128756345 15:70186300-70186322 TTGCCCCTTCAGCCCCACTGGGG - Intergenic
1128966265 15:72061433-72061455 GGTTCCCTTCTGGCCCAGGGTGG - Intronic
1129315358 15:74739829-74739851 TTGCTCCTTCAGGCCCAAGGTGG - Intergenic
1129656790 15:77529863-77529885 GTGCCCCTGCAGGGCCTGGCAGG + Intergenic
1129774784 15:78229671-78229693 GGGTCCCATCTGGCCCAGGGAGG - Intronic
1130400315 15:83546430-83546452 GGTTCCCTTCTGGCCCAGGGTGG + Intronic
1130768821 15:86903706-86903728 GTGCCCCTGGAGGCCTAGTGGGG - Intronic
1131397393 15:92097506-92097528 TTGCCCGTTAAGGCCCAGGGTGG + Intronic
1131830629 15:96352539-96352561 CTTCCCCTTCCGTCCCAGGGTGG - Intergenic
1132743310 16:1426651-1426673 GAGGCCCTTCTGGACCAGGGTGG + Intergenic
1132809695 16:1791614-1791636 CAGCGCCTTCAGGCCCAGGAAGG + Exonic
1132872040 16:2119638-2119660 GTGCCCTTCCTGGCCCTGGGTGG - Intronic
1134443042 16:14310739-14310761 GTGCCCCTAGAGGCCAAGGGAGG - Intergenic
1134520484 16:14917258-14917280 GTGCCCTTCCTGGCCCTGGGTGG + Intronic
1134551090 16:15138716-15138738 GTGCCCTTCCTGGCCCTGGGTGG - Intronic
1134708156 16:16315909-16315931 GTGCCCTTCCTGGCCCTGGGTGG + Intergenic
1134715372 16:16355942-16355964 GTGCCCTTCCTGGCCCTGGGTGG + Intergenic
1134951446 16:18352736-18352758 GTGCCCTTCCTGGCCCTGGGTGG - Intergenic
1134959385 16:18396217-18396239 GTGCCCTTCCTGGCCCTGGGTGG - Intergenic
1137225774 16:46506796-46506818 GAGTCCCTTCAGGCCCCAGGTGG - Intergenic
1137533609 16:49300246-49300268 TTGCCCCTTCAGGCCTGGGGTGG - Intergenic
1137733968 16:50710732-50710754 GAGCTCCTCCAGGCCCAGGGTGG - Exonic
1139383472 16:66549388-66549410 GTGTTCCTCTAGGCCCAGGGCGG + Intronic
1140743272 16:77960437-77960459 GTGCCCCTTCAGGCCCAGGGTGG - Intronic
1141490071 16:84366926-84366948 CTGGCCCTTCAGGCCTTGGGTGG + Intergenic
1142010575 16:87711849-87711871 GTCCCCGTGCAGGCCCAAGGGGG - Intronic
1142010603 16:87711925-87711947 GTCCCCGTGCAGGCCCAAGGGGG - Intronic
1142088532 16:88197730-88197752 GTGGACCTTCCGGCCCTGGGGGG - Intergenic
1142682780 17:1560294-1560316 GTGCCGCTCCAGGCCCAGCCCGG - Intronic
1143017301 17:3897829-3897851 GTTCTCCTGCAGGCCCAGGGTGG + Exonic
1144136549 17:12300836-12300858 GTGCCCACCCAGACCCAGGGTGG - Intergenic
1144713847 17:17420873-17420895 CTCCCCTTTCAGGGCCAGGGTGG + Intergenic
1145907592 17:28524798-28524820 GTGTCCTTTGAGGGCCAGGGTGG - Exonic
1151658645 17:75507535-75507557 GGGCCCCTACCTGCCCAGGGTGG + Intronic
1151958936 17:77394855-77394877 TTTCCCCTCCAGGCCCATGGCGG - Intronic
1152179256 17:78807541-78807563 CTGGGACTTCAGGCCCAGGGTGG + Exonic
1152592816 17:81222234-81222256 CCGCCCCTTCAGGTCCTGGGAGG - Intronic
1152749771 17:82057260-82057282 CTGCCTCCTCAGCCCCAGGGAGG - Exonic
1152749908 17:82057834-82057856 CTGCCCTCTCAGACCCAGGGAGG - Intronic
1152984808 18:311834-311856 GTGCCACTGCATGCCCAGGCTGG - Intergenic
1153475575 18:5495011-5495033 CTGCCCCTTCAGGGCCTGTGTGG - Intronic
1153991470 18:10404273-10404295 GTGTCCCTGCAGGGACAGGGAGG + Intergenic
1154328855 18:13413105-13413127 GTGCCACGTCAAGCCCAGGATGG + Intronic
1160804980 19:988678-988700 CTGCCCCTGGAGGCCCTGGGAGG + Intronic
1161361411 19:3852141-3852163 GTGGCTCTTCTGGCCCAGGCGGG + Intronic
1162086969 19:8254924-8254946 GTGCCCACTAAGGCTCAGGGAGG - Intronic
1162382498 19:10339763-10339785 GTGGCCCTTGGGGGCCAGGGTGG + Exonic
1162498675 19:11038409-11038431 GGCCCCCTGCAGACCCAGGGCGG - Intronic
1162787270 19:13043568-13043590 GTCCCCCTTCAAGTCCTGGGAGG - Intronic
1163584671 19:18157245-18157267 CTGCTCCTTCAGGCCGAGGCAGG - Intronic
1163681474 19:18684673-18684695 CTGCCCTCTCAGGACCAGGGTGG + Intronic
1164329510 19:24240041-24240063 GAGCCCTTTGAGGCCTAGGGTGG - Intergenic
1165046133 19:33106507-33106529 GTGACCCTCCAGGTCCAGAGGGG + Intronic
1166079353 19:40434051-40434073 GTACCCCGGCCGGCCCAGGGCGG + Intergenic
1166830972 19:45639426-45639448 CTGCCGCTTCCGGCCCTGGGAGG + Intronic
1166921899 19:46233876-46233898 ATACCTCTTCAGGCCCAGGGCGG - Intergenic
1167713510 19:51126143-51126165 CTGCTCCTCCAGCCCCAGGGAGG - Intronic
1167774263 19:51544586-51544608 CTGCTCCCTCAGCCCCAGGGAGG + Intergenic
1167948882 19:53010693-53010715 CTGCCCCTACGGGCCAAGGGGGG + Intergenic
1167970181 19:53184411-53184433 GTTCCCCAGCAGACCCAGGGTGG - Intronic
1168147921 19:54430028-54430050 GTGCCCGGTCCTGCCCAGGGTGG + Intronic
1168175614 19:54625480-54625502 GTGCCTCTGTAGGCCAAGGGGGG + Intronic
1168339148 19:55613864-55613886 GTCCACCTTCAAGCCCAAGGCGG + Exonic
926217515 2:10914460-10914482 CTCCCCCTGCAGGCCCAGGATGG + Intergenic
926327715 2:11799642-11799664 GAGCCCACTGAGGCCCAGGGAGG + Intronic
930557773 2:52921660-52921682 GAGCCCTTTCAAGCCAAGGGAGG - Intergenic
930693110 2:54384796-54384818 GTGCCCATTCACGGCCAGGCGGG + Intergenic
930705781 2:54503410-54503432 GTTCTCCTGCAGGCCCAGTGTGG + Intronic
931817729 2:65921234-65921256 GTGCCACATCAGGTCCAAGGGGG - Intergenic
933812582 2:86042309-86042331 TGGCCCATTCAAGCCCAGGGAGG + Intronic
937144186 2:119628102-119628124 GGGCCCCACCTGGCCCAGGGAGG + Intronic
937293993 2:120798834-120798856 GTGCCCCCACAGGCCAAGGATGG - Intronic
938537223 2:132256730-132256752 GTGCGCCTTCGGGACCAGGTCGG - Intronic
942186066 2:173426336-173426358 ATGCCCCTTCAGGACCTGGAAGG + Intergenic
942314929 2:174689578-174689600 CCTCCTCTTCAGGCCCAGGGTGG - Intergenic
944046131 2:195413954-195413976 GGTTCCCTTCTGGCCCAGGGTGG - Intergenic
944432411 2:199647321-199647343 GTGTCCCTTCAGGCCTAGGGTGG + Intergenic
946361730 2:219223027-219223049 GTGCCCCCCCAGACCCAGGAGGG + Intronic
947118444 2:226795588-226795610 CTGCCCCTTGAGGCCCAGTCGGG + Exonic
947169319 2:227295278-227295300 GGGCCCCTCCAGGCCCAAGAGGG + Exonic
948706020 2:239792918-239792940 GTGACCCTGCAGGGCCTGGGTGG - Intronic
948789132 2:240368314-240368336 GGGCCCCATGTGGCCCAGGGTGG - Intergenic
948948803 2:241235840-241235862 CAGCCCCTTCAGGCCCACGTAGG + Intronic
1168962961 20:1881412-1881434 GAAACCCTGCAGGCCCAGGGAGG - Intergenic
1169623934 20:7541016-7541038 GGTTCCCTTCTGGCCCAGGGTGG - Intergenic
1171106571 20:22439130-22439152 CTGCCCCTACAGGCCCTGGGTGG + Intergenic
1171767991 20:29300692-29300714 GCGCGCCTTCAGGACCAGGTCGG - Intergenic
1171810692 20:29742918-29742940 GCGCGCCTTCAGGACCAGGTTGG - Intergenic
1172006866 20:31823925-31823947 GGGCACCTTCAGGCAGAGGGAGG - Intronic
1173416495 20:42861201-42861223 ATTGCCCTTCAGACCCAGGGTGG + Intronic
1173767777 20:45629856-45629878 CTGCTGCTGCAGGCCCAGGGAGG + Exonic
1173773797 20:45685928-45685950 CTGCTGCTGCAGGCCCAGGGAGG - Intronic
1173809709 20:45948413-45948435 GTGCTCCCTAGGGCCCAGGGAGG + Intergenic
1174063941 20:47851515-47851537 TTGCCCCTTCAGGCCTTGGGAGG - Intergenic
1174202537 20:48817102-48817124 GTGCCCTTTCAGGTTCATGGAGG + Intronic
1174962414 20:55173672-55173694 CTGCTTCTTCAGGTCCAGGGTGG - Intergenic
1175796455 20:61774227-61774249 ATGCCCCTTGAGGGCCAGGCAGG + Intronic
1175907723 20:62389605-62389627 GAGCCCCTCCAGGGCCAGGCAGG + Exonic
1175979822 20:62732890-62732912 GTGGTCCTCCAGGCCCAGGCAGG - Intronic
1175986118 20:62764915-62764937 GTGTCCCTCCTGGCCCAGAGCGG + Intergenic
1175999923 20:62827153-62827175 GGGCCCCTCCAGGCCCGGGCGGG - Intronic
1176319613 21:5298480-5298502 GAGCGCCTTGAGGCCCATGGTGG - Intergenic
1176320231 21:5309767-5309789 GAGCCCTTTCAGGCCTATGGTGG + Intergenic
1176477045 21:7229540-7229562 GAGCGCCTTGAGGCCCATGGTGG - Intergenic
1176477696 21:7241489-7241511 GAGCCCTTTCAGGCCTATGGTGG + Intergenic
1176614958 21:9018902-9018924 GTGCCCCTTCAGACCATGTGAGG - Intergenic
1176710253 21:10144969-10144991 GTGCCCCTTCAGACCATGTGAGG + Intergenic
1179429808 21:41313085-41313107 GTGCCATTTCAGGCCTAGAGTGG - Intronic
1179484995 21:41704375-41704397 CTGCCTGTCCAGGCCCAGGGAGG + Intergenic
1180041517 21:45282736-45282758 GTGCACCTTCAGGGCCAGCCTGG + Intronic
1180087273 21:45513419-45513441 GTTCCCCTTCAGTCCCAAGGAGG - Exonic
1180251679 21:46594334-46594356 GCCCACCTTCAGGCACAGGGAGG + Intergenic
1180312840 22:11253383-11253405 GTGCGCCTTCGGGACCAGGTCGG - Intergenic
1180631721 22:17234477-17234499 GTGTGCCTTCAGGCCAATGGTGG + Intergenic
1181027171 22:20132849-20132871 GGGCTCCTTCAGGCACAAGGAGG + Intronic
1182415371 22:30217911-30217933 GTGCTTTGTCAGGCCCAGGGCGG + Intergenic
1183650769 22:39152286-39152308 TTTCCCCTTCAGCCCCAGCGTGG + Intronic
1184102321 22:42347382-42347404 CAGCCCCCACAGGCCCAGGGAGG + Intergenic
1184160124 22:42692846-42692868 GTGCCCCATCAGGAGCAGGTTGG + Exonic
1184209899 22:43029284-43029306 GAGCCACTTCAGGGGCAGGGAGG - Intergenic
1184316773 22:43699395-43699417 TTGCCCCCTCAGGCCTAGGAGGG + Intronic
1184483976 22:44765307-44765329 GTGCCCCTGCATTGCCAGGGAGG + Intronic
1184875426 22:47271612-47271634 GTGCACCTATAGTCCCAGGGAGG - Intergenic
1185249700 22:49794242-49794264 CTGCTCCTCCAGGCCCAGGTGGG + Exonic
950186534 3:10948964-10948986 GGGGCCCATCAGGCCCTGGGAGG - Intergenic
950509295 3:13416081-13416103 GAGTCCTTTCAGGGCCAGGGAGG - Intronic
950569394 3:13790749-13790771 CTGCCCCTTCAGGCCCAGGGTGG + Intergenic
950766658 3:15277974-15277996 GTGACCCTGCAGGCACGGGGTGG + Intronic
954369181 3:50161283-50161305 TTGCCCCTGGAGGTCCAGGGAGG - Intronic
954610817 3:51943697-51943719 GTGTCCCGTCAGGTCCAGGCGGG + Intronic
955320344 3:57969995-57970017 TTGCCTCTTCCTGCCCAGGGTGG + Intergenic
957474079 3:80701943-80701965 TTGCCACTTCAGTCCTAGGGTGG - Intergenic
958228678 3:90866191-90866213 GTGCCGCTTGAGGCCTATGGTGG + Intergenic
958231401 3:90912066-90912088 GTGCCGCTTGAGGCCTATGGTGG + Intergenic
958239399 3:91046288-91046310 GTGCCGCTTGAGGCCTATGGTGG + Intergenic
961317576 3:126050979-126051001 GTTCCCCTTCAGGCCCACCAGGG + Exonic
961778557 3:129307467-129307489 GAGCTCCTACAGGCCCAGGTAGG - Intergenic
962583333 3:136818198-136818220 TTGCCCCTTCAGGCCTGGAGTGG - Intergenic
962862610 3:139418764-139418786 GGCTCCCTTCTGGCCCAGGGTGG + Intergenic
963802302 3:149688183-149688205 GGTTCCCTTCTGGCCCAGGGTGG - Intronic
964339002 3:155688638-155688660 GACTCCCTTCTGGCCCAGGGCGG - Intronic
967935974 3:194727932-194727954 CTTCCCCCTCAGGCCCTGGGGGG + Intergenic
968049815 3:195646917-195646939 GTGCACCTGGAGACCCAGGGAGG + Intergenic
968096287 3:195932975-195932997 GGTTCCCTTCTGGCCCAGGGTGG - Intergenic
968097478 3:195941672-195941694 GTGCACCTGGAGACCCAGGGAGG - Intergenic
968097865 3:195944803-195944825 GTGCACCTGCAGACCCGGGGAGG - Intergenic
968097909 3:195945132-195945154 GTGCACCTGCAGACCCGGGGAGG - Intergenic
968105628 3:195999493-195999515 GTGCACCTGGAGCCCCAGGGTGG - Intergenic
968218540 3:196915455-196915477 GGTTCCCTTCTGGCCCAGGGTGG - Intronic
968304919 3:197643933-197643955 GTGCACCTGCAGACCCGGGGAGG - Intergenic
968438601 4:609800-609822 CTGCCCCTTCAGGCTCAGGTGGG + Intergenic
968690362 4:1986948-1986970 CTGCACCTGCTGGCCCAGGGAGG - Intronic
968726984 4:2252341-2252363 GTGTCCCTGCACGCCCTGGGGGG - Intronic
968757695 4:2425545-2425567 GTGGCCCTTCAAGCCCAGCCTGG + Intronic
970442517 4:16093889-16093911 GAGCTCCCTCAGGCCCTGGGTGG - Intergenic
970785741 4:19794021-19794043 GTGCCCATTCAGACTGAGGGTGG - Intergenic
972774498 4:42228776-42228798 CTCCCCGTTCAGGCCTAGGGTGG - Intergenic
975295280 4:72727103-72727125 GGTTCCCTTCTGGCCCAGGGTGG - Intergenic
977825798 4:101530134-101530156 GTGACCTTTCAGGACTAGGGAGG - Intronic
979238895 4:118431302-118431324 CTGCCCATTGAGGCCCAGAGGGG + Intergenic
981089759 4:140720616-140720638 GTGGCCCGTCAGGGCCAGTGAGG + Intronic
985741019 5:1617561-1617583 GTGCACCTGGAGCCCCAGGGTGG - Intergenic
985741601 5:1620333-1620355 GTGCACCTGGAGACCCAGGGGGG - Intergenic
985778712 5:1858557-1858579 GCGCCCCTCCTGGCCCAGGGAGG - Intergenic
985885064 5:2671135-2671157 GTGGTCCCACAGGCCCAGGGTGG + Intergenic
986085036 5:4436664-4436686 GATCCTCTTCAAGCCCAGGGAGG + Intergenic
986687623 5:10288374-10288396 GTGCACGTTGTGGCCCAGGGAGG - Intronic
988064780 5:26219574-26219596 GGTTCCCTTCTGGCCCAGGGTGG - Intergenic
990597084 5:57322857-57322879 CTGCCCTTTGAAGCCCAGGGTGG + Intergenic
990810304 5:59715391-59715413 GTGCCCCATCGGGCATAGGGGGG - Intronic
990990480 5:61678781-61678803 GTGCCAGGTGAGGCCCAGGGAGG + Intronic
994310812 5:98268230-98268252 GGTTCCCTTCTGGCCCAGGGTGG - Intergenic
995708886 5:115014678-115014700 GTCACCCTTCAGACCTAGGGTGG - Intergenic
997184371 5:131866674-131866696 CTGCCTCTTCAGCCCCAGGAGGG + Intronic
997429627 5:133828638-133828660 GTGATCCTCCAGGCCCAAGGGGG + Intergenic
998411490 5:141914613-141914635 CTGCCCCTTTAGGCCCCGCGTGG - Intergenic
998436009 5:142109153-142109175 CCGCCCCTCCAGGCCCAGCGCGG - Intronic
1001547851 5:172581539-172581561 CTTCCCTTTCAGGCCTAGGGTGG - Intergenic
1001675273 5:173507219-173507241 TTGCCCCTTCAAGCTCGGGGCGG - Intergenic
1001775739 5:174327919-174327941 GTGGCCCCACATGCCCAGGGTGG - Intergenic
1002177514 5:177409617-177409639 GTGCCCCACCAGGCTCAGGAGGG - Intronic
1002781872 6:373188-373210 GTGCCCCTCCAGGCCCTCGCAGG + Intergenic
1005505788 6:26468021-26468043 GTGCCCCTTCAGGCACCTAGGGG + Exonic
1005859608 6:29890140-29890162 GTGCAACTGCAGACCCAGGGTGG - Intergenic
1006365807 6:33614448-33614470 TTGCCTTCTCAGGCCCAGGGTGG + Intergenic
1006845703 6:37059914-37059936 GTGCTCCTTCAGGCTCAGCCAGG + Intergenic
1008495137 6:52125388-52125410 GTGCCACTTCTGTCCCAGGAGGG + Intergenic
1008727581 6:54441217-54441239 GGCTCCCTTCTGGCCCAGGGAGG + Intergenic
1010301380 6:74264152-74264174 GACCCCCATAAGGCCCAGGGAGG - Intergenic
1011446940 6:87451410-87451432 GGTTCCCTTCTGGCCCAGGGTGG - Intronic
1016647221 6:146424235-146424257 GTGGCACTTCCGGTCCAGGGAGG + Intronic
1017411341 6:154170743-154170765 ATGTCCCTTCACACCCAGGGTGG + Intronic
1017491524 6:154949922-154949944 GGTTCCCTTCTGGCCCAGGGTGG + Intronic
1018798154 6:167203070-167203092 GTGCCCTTTCAGGCCATGGCTGG + Intergenic
1019288173 7:234088-234110 GTGCCCTTTGAGGCCCAGGGAGG + Intronic
1019723335 7:2586848-2586870 GTGGCCCCTGAGGCCCAGCGGGG + Intronic
1020076749 7:5263456-5263478 GGGTCGTTTCAGGCCCAGGGAGG - Intergenic
1021674210 7:23064165-23064187 GTGCACCTTCAGACACAGAGTGG - Intergenic
1022350935 7:29565773-29565795 GTGACCCATCCGACCCAGGGCGG - Intronic
1022375521 7:29807472-29807494 GCGCTCCTCCAGGTCCAGGGCGG - Intronic
1023241001 7:38147091-38147113 GAGTCCCTTTTGGCCCAGGGTGG - Intergenic
1023868260 7:44249168-44249190 GGGCCCCTTCAGGAACAAGGAGG - Intronic
1024533251 7:50410232-50410254 GTACCTCCTCAGGCCCAGGGGGG - Intergenic
1024654146 7:51434874-51434896 GTGTCCCTTCAGGACCTGGCCGG + Intergenic
1025164100 7:56695636-56695658 ATGCCCATTCATGCCCAGAGAGG + Intergenic
1025307821 7:57880549-57880571 GTGCGCTTTGAGGCCTAGGGAGG - Intergenic
1025309296 7:57908843-57908865 GAGCCCCTTGAGGCCTATGGTGG - Intergenic
1025309741 7:57917507-57917529 GTGCGCTTTGAGGCCTAGGGAGG + Intergenic
1025706181 7:63866435-63866457 ATGCCCATTCATGCCCAGAGAGG - Intergenic
1026767815 7:73171599-73171621 GTACCCCTGTAGTCCCAGGGAGG - Intergenic
1026786313 7:73303815-73303837 GGGCGCCTTCAGGTACAGGGCGG - Exonic
1027044281 7:74981307-74981329 GTACCCCTGTAGTCCCAGGGAGG - Intronic
1027079360 7:75221051-75221073 GTACCCCTGTAGTCCCAGGGAGG + Intergenic
1027107769 7:75416180-75416202 GGGCGCCTTCAGGTACAGGGCGG + Intergenic
1027267492 7:76502457-76502479 GTGCCCCCACTGGCCCAGGGCGG + Intronic
1027319308 7:77002322-77002344 GTGCCCCCACTGGCCCGGGGCGG + Intergenic
1028802300 7:94980263-94980285 GGGCCGCATGAGGCCCAGGGTGG - Intronic
1029250463 7:99232720-99232742 GTGCCCAGTCAGGCCCTGGAAGG + Intergenic
1030273678 7:107696795-107696817 GTTCCCCTCTAGGCCCAGGAGGG - Intronic
1032858776 7:135858681-135858703 GTGGCCCTGCCTGCCCAGGGAGG + Intergenic
1034044024 7:147908489-147908511 GAGCCCCTCCAGGAACAGGGAGG + Intronic
1034446549 7:151116755-151116777 CCGCCCCGTCAGGGCCAGGGTGG - Intronic
1034537618 7:151735650-151735672 TTGCCCCACCTGGCCCAGGGAGG - Intronic
1035141529 7:156767174-156767196 GTTCCCCTGCATGCTCAGGGGGG - Intronic
1035459289 7:159029409-159029431 CTGCTCCTTCAGGCGAAGGGTGG - Exonic
1035560877 8:602612-602634 GTGCCCCTCCAGCCTCAGGGAGG - Intergenic
1036557659 8:9874218-9874240 GGGCCCCTTCATCCCCATGGAGG - Intergenic
1036662427 8:10716673-10716695 GTGCACCTGCAGGCCCACCGTGG - Intergenic
1037369770 8:18163229-18163251 GATTCCCTTCAGGCCAAGGGTGG - Intergenic
1037674006 8:21039013-21039035 CAGCACCTTCAGGTCCAGGGTGG - Intergenic
1037760757 8:21739990-21740012 TGGCCCCTCCAAGCCCAGGGAGG + Intronic
1037815482 8:22109546-22109568 GTGCCCCCCCAGTTCCAGGGCGG - Intergenic
1037987018 8:23296386-23296408 GAGGCCCTGCAGGCCCAGTGGGG - Intergenic
1038828348 8:31032381-31032403 GTGGCCTTTCAGGCCCAGGTGGG + Exonic
1039608709 8:38902262-38902284 GTGTCCCTGCACGCCCAGAGAGG + Intronic
1040959718 8:53019033-53019055 GTGCCCCTTGAGGCGGGGGGAGG + Intergenic
1041828312 8:62123510-62123532 GTGCACCTACTGGCCCAGGAAGG - Intergenic
1041847657 8:62349861-62349883 GTGTCTCTTCAGGTCCTGGGAGG - Intronic
1043453081 8:80387825-80387847 GTGAACCTTCAGGCCCGGTGCGG - Intergenic
1043456990 8:80422411-80422433 TTGCCTCTTTATGCCCAGGGTGG + Intergenic
1043994791 8:86799666-86799688 TTGCCCCTTCAGGACTAAGGTGG + Intergenic
1044146731 8:88725161-88725183 GTGCTGGTTCTGGCCCAGGGTGG + Intergenic
1045547179 8:103140030-103140052 CGGTCCCTTCAAGCCCAGGGTGG - Intronic
1046902834 8:119541246-119541268 GTGGCCCCTCAGTCCCAGGTTGG + Intergenic
1049921550 9:369478-369500 ATGCTGCTTCAGGCCCAAGGAGG + Intronic
1053417644 9:37956650-37956672 ATGCTCCCACAGGCCCAGGGCGG - Intronic
1053647226 9:40130667-40130689 GTGCCCCTTCAGACCATGTGAGG + Intergenic
1053716556 9:40899938-40899960 GAGCGCCTTCAGGCCTATGGTGG + Intergenic
1053758499 9:41333176-41333198 GTGCCCCTTCAGACCATGTGAGG - Intergenic
1053939059 9:43209414-43209436 GAGCGCCTTGAGGCCTAGGGTGG + Intergenic
1054075979 9:60530578-60530600 GAGCGCCTTCAGGCCTATGGTGG - Intergenic
1054328227 9:63728623-63728645 GTGCCCCTTCAGACCATGTGAGG + Intergenic
1054537352 9:66245503-66245525 GTGCCCCTTCAGACCATGTGAGG - Intergenic
1056136245 9:83631895-83631917 GTGCCCCTGCAGGCTCAGATAGG - Intronic
1056230606 9:84539190-84539212 GTTCCCCTTCTGGCCCAGAGTGG + Intergenic
1057198532 9:93128266-93128288 GTGCAGCGTCAGGCCCAGGGTGG - Intronic
1057550704 9:96049419-96049441 GAGCCCATTCAGGCCCTCGGTGG - Intergenic
1057857423 9:98612155-98612177 GGGCCCCCTCAGGCCCAGCATGG + Intronic
1057953940 9:99392357-99392379 CTCCCCCTACATGCCCAGGGAGG + Intergenic
1058522720 9:105828227-105828249 GTTCCCCCTCAGACCCAGGTGGG + Intergenic
1059438558 9:114290216-114290238 CAGCCCCTGCAGGCCCTGGGGGG - Exonic
1059756394 9:117297656-117297678 TTGCCCCTTCAGGCCTAGGGTGG - Intronic
1060358443 9:122931838-122931860 GGAGCCCTTCAGGCCCAAGGAGG - Intergenic
1061204156 9:129153293-129153315 GTGCCACTGCAGGCGGAGGGCGG + Intergenic
1061673251 9:132201173-132201195 GTGCCCCTTCAACCCCAGCAGGG + Intronic
1061861131 9:133469304-133469326 GGGCCCCAGCAGGCCCAGGGAGG - Exonic
1062137170 9:134935316-134935338 AAGCCCCTCCAGTCCCAGGGAGG - Intergenic
1062331160 9:136045547-136045569 GAGCCCCATCAGGCACAGGAGGG + Intronic
1062611196 9:137374379-137374401 GCGCCCCCAGAGGCCCAGGGAGG + Intronic
1202795017 9_KI270719v1_random:113964-113986 GTGCCCCTTCAGACCATGTGAGG + Intergenic
1203383970 Un_KI270438v1:543-565 GAGCCCCTTCTGGCCTATGGTGG + Intergenic
1203357113 Un_KI270442v1:165399-165421 GAGCCCTTTCAGGCCTATGGTGG + Intergenic
1188137099 X:26504352-26504374 GTCCACTTTCAGCCCCAGGGGGG - Intergenic
1188507006 X:30893562-30893584 GTTACCCTTCAGGCCCAGCAAGG - Intronic
1188727859 X:33607366-33607388 CTGCCCCTGCAGGCTCAGGAGGG - Intergenic
1190537944 X:51447783-51447805 GATTCCCTTCTGGCCCAGGGTGG + Intergenic
1190878258 X:54474885-54474907 GGGCTCCTCCAGGCCCAAGGAGG - Intronic
1192185788 X:68946071-68946093 CTGCCCCTTCAGGCCAAGTGGGG - Intergenic
1194095723 X:89636535-89636557 GGTCTCCTTCTGGCCCAGGGTGG - Intergenic
1195601357 X:106752109-106752131 GTGTCCCTTCTGGCCCAGGGTGG - Intronic
1198161477 X:134012818-134012840 TTGGCCCTTCAGGCCTAGAGGGG - Intergenic
1200115765 X:153769084-153769106 TGGCCCCTTCAGCCCCAGGATGG - Intronic
1200379504 X:155819938-155819960 GGTTCCCTTCTGGCCCAGGGTGG - Intergenic
1201077119 Y:10196698-10196720 GTGCACCTTCGGGACCAGGTGGG + Intergenic
1201096418 Y:10622472-10622494 GAGCCCCTTGAGGCCCATTGTGG - Intergenic
1201471954 Y:14343779-14343801 GTGCCCCTCCAAGCCATGGGAGG - Intergenic
1202386655 Y:24333110-24333132 CTGCCCATTGAGGCCCAGAGGGG + Intergenic
1202484130 Y:25337018-25337040 CTGCCCATTGAGGCCCAGAGGGG - Intergenic