ID: 1140743576

View in Genome Browser
Species Human (GRCh38)
Location 16:77962386-77962408
Sequence CCCCTACCTATGGCTCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140743576_1140743586 21 Left 1140743576 16:77962386-77962408 CCAAAGGGAGCCATAGGTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1140743586 16:77962430-77962452 AAGCAGAGGAAGGCCAGGGTAGG 0: 1
1: 0
2: 11
3: 107
4: 703
1140743576_1140743582 7 Left 1140743576 16:77962386-77962408 CCAAAGGGAGCCATAGGTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1140743582 16:77962416-77962438 ATAGGTAGGGATGCAAGCAGAGG 0: 1
1: 0
2: 2
3: 8
4: 218
1140743576_1140743580 -7 Left 1140743576 16:77962386-77962408 CCAAAGGGAGCCATAGGTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1140743580 16:77962402-77962424 GTAGGGGTGCTGACATAGGTAGG 0: 1
1: 0
2: 0
3: 7
4: 85
1140743576_1140743581 -6 Left 1140743576 16:77962386-77962408 CCAAAGGGAGCCATAGGTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1140743581 16:77962403-77962425 TAGGGGTGCTGACATAGGTAGGG 0: 1
1: 0
2: 0
3: 3
4: 91
1140743576_1140743585 17 Left 1140743576 16:77962386-77962408 CCAAAGGGAGCCATAGGTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1140743585 16:77962426-77962448 ATGCAAGCAGAGGAAGGCCAGGG 0: 1
1: 0
2: 3
3: 44
4: 420
1140743576_1140743583 11 Left 1140743576 16:77962386-77962408 CCAAAGGGAGCCATAGGTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1140743583 16:77962420-77962442 GTAGGGATGCAAGCAGAGGAAGG 0: 1
1: 0
2: 6
3: 36
4: 444
1140743576_1140743584 16 Left 1140743576 16:77962386-77962408 CCAAAGGGAGCCATAGGTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1140743584 16:77962425-77962447 GATGCAAGCAGAGGAAGGCCAGG 0: 1
1: 0
2: 0
3: 39
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140743576 Original CRISPR CCCCTACCTATGGCTCCCTT TGG (reversed) Intronic
900640390 1:3685581-3685603 CCCCTACCCCTGACTCCCATGGG + Intronic
900719255 1:4164716-4164738 CCTGCACCTATGCCTCCCTTGGG + Intergenic
900926265 1:5708222-5708244 CCCCTACTTCTGGTTTCCTTTGG - Intergenic
901005974 1:6171692-6171714 CTCCTCCCTATGGCTCCATCTGG + Intronic
902580141 1:17402908-17402930 CCTCTACCAAGGGCTGCCTTAGG + Intergenic
902651666 1:17841461-17841483 CAGCTACATATGCCTCCCTTGGG - Intergenic
902656113 1:17869477-17869499 CCCCCACCTGCGGCTCCCTGTGG - Intergenic
902879119 1:19359452-19359474 CCCCTGCCCAGGGCTCCCTCAGG + Intronic
903878551 1:26492875-26492897 ACACCACCTGTGGCTCCCTTTGG + Intergenic
904058675 1:27689146-27689168 CCCAAAAATATGGCTCCCTTTGG - Intergenic
904290042 1:29478983-29479005 CTCCTTCCCCTGGCTCCCTTGGG - Intergenic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906340883 1:44979674-44979696 CCACTACGCATGGCCCCCTTTGG - Intronic
915248278 1:154571078-154571100 CCCCTCCCCATGTCTCCCTCTGG + Intronic
917489259 1:175483731-175483753 CCCCACCATCTGGCTCCCTTGGG - Intronic
919045954 1:192452222-192452244 CCCCTGCAGATGGCTGCCTTAGG - Intergenic
922233291 1:223704623-223704645 CCCTCAGCTATGGCTCCCTTTGG - Intronic
1065623545 10:27608079-27608101 CCCCTCCCTTTGGTTCCTTTGGG + Intergenic
1065742093 10:28806146-28806168 CCCCCACACATGGCTACCTTGGG + Intergenic
1065917471 10:30365425-30365447 CCACTACCTCTGGCTCCTTCTGG + Intronic
1066990053 10:42504745-42504767 CCTCTACCTGTGACTGCCTTAGG - Intergenic
1067256574 10:44647751-44647773 CCCCTGCCAATGCCTCTCTTAGG + Intergenic
1068685826 10:59869100-59869122 CTCTTTCCTATGGCTCCCATTGG - Intronic
1069455864 10:68553354-68553376 CCCCAGCCTAAGGCTACCTTGGG - Intergenic
1074883026 10:117673129-117673151 CCCCTGCCTATGGCAGGCTTGGG - Intergenic
1077242428 11:1517601-1517623 CCCCCACCTCTGGCTCCCCCAGG + Intergenic
1079486410 11:20940241-20940263 CCCCTAGACATGGCTACCTTGGG + Intronic
1080281987 11:30567903-30567925 TCCCTCCCTGTGTCTCCCTTGGG + Intronic
1081212827 11:40357176-40357198 CCCCTATCTTTGGCTGACTTTGG - Intronic
1083926443 11:65809798-65809820 CCCCCACCTATGGCTTCATGGGG + Intergenic
1088135520 11:106552122-106552144 CCCCTGCCCTTGGCTCCCTCTGG - Intergenic
1088162620 11:106891155-106891177 CCACTACCAATGGCTCACATTGG - Intronic
1090518817 11:127457375-127457397 ACCTTACCTATGACTCCCGTGGG + Intergenic
1092048736 12:5452738-5452760 CCCCCACCTAGGGCAGCCTTGGG + Intronic
1096271010 12:50166734-50166756 CCCCTTCCTATCCCTCTCTTCGG + Intronic
1096935269 12:55267376-55267398 TGCCTACCTATGGCTACCTATGG + Intergenic
1099799795 12:87442761-87442783 CCCTGACCAATGGCTACCTTTGG - Intergenic
1101755237 12:107616338-107616360 TGCCTACCTAGGGCTCCCTGAGG - Intronic
1101838187 12:108309759-108309781 CCCCTCCCTATTGTTCCCTGGGG + Intronic
1106587956 13:31073376-31073398 CCCATTCCCATGGCTCCCTTTGG + Intergenic
1109446986 13:62453869-62453891 TCCCTAGCTATGACTCCCATTGG + Intergenic
1112738006 13:102443034-102443056 ACCCTCCCTATGGATCCCTGTGG - Intergenic
1116974572 14:51101472-51101494 CCCCTACCTCAGGGTCCCCTTGG - Intergenic
1118318892 14:64741988-64742010 CCCCTTCCCAGGGCTCCCTCCGG - Exonic
1120394996 14:83957173-83957195 CGGCTGCCGATGGCTCCCTTCGG - Intergenic
1120997045 14:90424965-90424987 CCCCTTCCTACGTCTCCCTGAGG - Intergenic
1125446434 15:39762586-39762608 CCCCTTCATATGGCTTGCTTGGG + Intronic
1128758811 15:70200915-70200937 GCCCTAATTATGGCTTCCTTTGG - Intergenic
1132061495 15:98695974-98695996 CCCCTTACTAAGTCTCCCTTAGG + Intronic
1132877882 16:2148442-2148464 CCCCTGCCCGTGGCTGCCTTGGG - Intronic
1135509719 16:23071915-23071937 CCACTCCCTGTAGCTCCCTTTGG + Intronic
1135620480 16:23951025-23951047 CCCATCCCTATGGCTCCTCTGGG - Intronic
1138413572 16:56858415-56858437 CCCCAACCAATGGCTCCCCCAGG - Intergenic
1139163056 16:64534687-64534709 TCCCTACCTATTTCTTCCTTGGG + Intergenic
1140743576 16:77962386-77962408 CCCCTACCTATGGCTCCCTTTGG - Intronic
1142150195 16:88509304-88509326 CCCCGCCCTGTGGCTCCCATAGG - Intronic
1144653437 17:17020964-17020986 CCCCCACCTCTGGCTCACTGTGG - Intergenic
1145990321 17:29075430-29075452 CCCCTAATGATGGCTCCCTGAGG + Exonic
1148182926 17:45620032-45620054 CCCCTACCTAAGTCCCCTTTAGG - Intergenic
1148371147 17:47100577-47100599 CCCCTACCTAAGTCCCCTTTAGG + Intergenic
1148718299 17:49731661-49731683 CCCATTCCTATGGCTCCAGTGGG + Intronic
1157818449 18:50748323-50748345 CCCCTTCCTGTGGCTGCCTGAGG + Intergenic
1161301715 19:3545933-3545955 CCCCTGCCTATGACTCCCATTGG + Intronic
929117802 2:38458875-38458897 CCCTTCTCTATGGGTCCCTTAGG - Intergenic
933209065 2:79544970-79544992 CCCCGGCCTATTGCTCCCTCAGG - Intronic
936011892 2:108930309-108930331 CCCCTTCCTATGTCAACCTTGGG - Intronic
936675483 2:114709155-114709177 CTCCTGCCAATGCCTCCCTTTGG - Intronic
937295091 2:120805260-120805282 CCCCTGCCTGTCGCTCCCCTTGG + Intronic
938201277 2:129374883-129374905 TCCTCACCTATGGCTCCCTTTGG + Intergenic
938812579 2:134867196-134867218 CCCCTACATTTGGCTCCTTCTGG - Intronic
942039131 2:172040492-172040514 CCTCTCACTATTGCTCCCTTGGG - Intronic
945264396 2:207876543-207876565 CCCTTACTTATGGGTCTCTTAGG + Intronic
946360942 2:219219009-219219031 CCCCTACCCACGGCTCCCATTGG + Intronic
947595654 2:231409994-231410016 CCCCTCCCTCTGGCGCACTTTGG + Intergenic
947810568 2:233001402-233001424 CCCCTACCTATGGGCCCGTGGGG - Intronic
1168849370 20:966045-966067 CCCCCACCTAACGCTCCCTCTGG - Intronic
1169046487 20:2537798-2537820 CTCCCGCCTATGGCTTCCTTGGG - Intronic
1170705068 20:18737521-18737543 CCCCTGCCTTGGGCTGCCTTGGG + Intronic
1179839105 21:44058776-44058798 CCCCTCACTGTGGCTCCCTCTGG - Intronic
1180785821 22:18547158-18547180 TCCCTACCTCTGGCACCCTCAGG + Intergenic
1180825181 22:18856671-18856693 CCCCTGCCTTGGGCTCCCTGGGG - Intronic
1181131104 22:20732883-20732905 TCCCTACCTCTGGCACCCTCGGG + Intronic
1181187549 22:21117876-21117898 CCCCTGCCTTGGGCTCCCTGGGG + Intergenic
1181211649 22:21292617-21292639 CCCCTGCCTTGGGCTCCCTGGGG - Intergenic
1181242746 22:21486712-21486734 TCCCTACCTCTGGCACCCTCAGG + Intergenic
1181397858 22:22634269-22634291 CCCCTGCCTTGGGCTCCCTGGGG + Intergenic
1181651549 22:24261789-24261811 CCCCTGCCTTGGGCTCCCTGGGG - Intergenic
1181705826 22:24648950-24648972 CCCCTGCCTTGGGCTCCCTGGGG + Intergenic
1203215304 22_KI270731v1_random:2815-2837 CCCCTGCCTTGGGCTCCCTGGGG + Intergenic
1203275326 22_KI270734v1_random:82574-82596 CCCCTGCCTTGGGCTCCCTGGGG - Intergenic
953452594 3:43016817-43016839 CCCCTTCCTATGACTGCCTATGG - Intronic
965758921 3:172054206-172054228 CCCATCCCTGTGGCTGCCTTGGG - Intronic
965865408 3:173199351-173199373 CACCTTCCCATAGCTCCCTTGGG + Intergenic
967209002 3:187150174-187150196 ACCCTCCCTATGGTTCCCTGTGG - Intronic
967685433 3:192410606-192410628 GCCCCACCTATGGCTCATTTTGG + Intronic
973782320 4:54300321-54300343 ACCCTCCCTATGGATCCCTGTGG - Intergenic
974474870 4:62365686-62365708 CACCTCTCTATGGCTCCCTTTGG - Intergenic
981548166 4:145915893-145915915 CTCTTGCCTATGTCTCCCTTTGG - Intronic
981687998 4:147476212-147476234 GTCCTGCCTATGTCTCCCTTTGG + Intergenic
988275560 5:29077458-29077480 CCCATACCTATTGCTTCATTAGG - Intergenic
989106732 5:37869827-37869849 CCCCTACCTCTCTGTCCCTTTGG + Intergenic
990381893 5:55227234-55227256 CCCCAACCTCTGGCTGGCTTCGG - Exonic
994384309 5:99111444-99111466 CTCCTACACATGGCTCCCATGGG - Intergenic
997516800 5:134495721-134495743 CCAGTACCCATGGCCCCCTTGGG - Intergenic
1001672401 5:173484875-173484897 GACCGACCTGTGGCTCCCTTTGG - Intergenic
1005989240 6:30892997-30893019 CCACTGCCTCTGCCTCCCTTGGG + Intronic
1007595644 6:43049713-43049735 CCCCTACCAAGTGCTCCCTGGGG - Intronic
1007642412 6:43352756-43352778 CCTTTATCTATGGTTCCCTTTGG - Intronic
1007983149 6:46179821-46179843 CCACTACCTATTGCTACCTAAGG - Intergenic
1008121537 6:47622441-47622463 GCCCTCCCTATGGATCCCTGTGG + Intronic
1012922605 6:105235026-105235048 CCCCTCCCGATGGATCCCTGTGG - Intergenic
1020084996 7:5305413-5305435 CCCCCACCTATAGCTTCCCTAGG + Exonic
1021191088 7:17620354-17620376 CCACTTCCTATTGCTACCTTAGG + Intergenic
1022496481 7:30856097-30856119 CCCCCACCTCTGCCTCCCATTGG + Intronic
1023876256 7:44287896-44287918 CCCCTTCCAATGGCTCTCTATGG + Intronic
1035327204 7:158072926-158072948 GCCATACCTATGGGCCCCTTGGG - Intronic
1037534636 8:19813093-19813115 CCCATACCCTTGGCTTCCTTAGG - Intergenic
1038397692 8:27259057-27259079 TTCCTACCTGTGGCTCCCTCTGG - Intergenic
1038797508 8:30722918-30722940 CCCCTACCTCTCTCTCCCCTAGG + Intronic
1039745534 8:40422812-40422834 CCCCTGCCTGGGGCTCCCTGTGG - Intergenic
1051148387 9:14054600-14054622 TCCCTAGCTATGTCTCTCTTGGG - Intergenic
1053318289 9:37071656-37071678 CCTCTTCCTCTGCCTCCCTTCGG - Intergenic
1053322413 9:37111341-37111363 CCTCTTCCTCTGCCTCCCTTCGG - Intergenic
1057181937 9:93035115-93035137 CCCCTCCCTATATCTCCCTCGGG + Intronic
1058200465 9:102032966-102032988 CCCCTACCTATGGCTGCCTATGG + Intergenic
1058602453 9:106684683-106684705 ACCCTACCTATATCTCCCTGTGG - Intergenic
1061303275 9:129718435-129718457 CCCCTGCCGATGGATCCCTCTGG + Intronic
1062381342 9:136288313-136288335 CCCCTCCCTCTGGCTCCTTTTGG - Intronic
1187217613 X:17292070-17292092 ACACTTCCTATGGCTCCCCTTGG - Intergenic
1189376102 X:40467295-40467317 CCCCACCCTTTGGCTCCCGTTGG - Intergenic
1190334414 X:49253679-49253701 CCCCTAGCCCTGACTCCCTTGGG - Intronic
1196008378 X:110859479-110859501 CTTCTGCCTATGCCTCCCTTTGG - Intergenic
1196723425 X:118875673-118875695 CCCCTATCTATGGCTTTGTTGGG - Intergenic