ID: 1140746268

View in Genome Browser
Species Human (GRCh38)
Location 16:77983067-77983089
Sequence ATTCCCAGCTTGGCATTCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140746268_1140746272 13 Left 1140746268 16:77983067-77983089 CCGCTGAATGCCAAGCTGGGAAT No data
Right 1140746272 16:77983103-77983125 GAACAAGGTCATACAATGAATGG No data
1140746268_1140746271 -2 Left 1140746268 16:77983067-77983089 CCGCTGAATGCCAAGCTGGGAAT No data
Right 1140746271 16:77983088-77983110 ATCTTAAATGTTAAGGAACAAGG No data
1140746268_1140746270 -9 Left 1140746268 16:77983067-77983089 CCGCTGAATGCCAAGCTGGGAAT No data
Right 1140746270 16:77983081-77983103 GCTGGGAATCTTAAATGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140746268 Original CRISPR ATTCCCAGCTTGGCATTCAG CGG (reversed) Intergenic
No off target data available for this crispr