ID: 1140746974

View in Genome Browser
Species Human (GRCh38)
Location 16:77989083-77989105
Sequence CCAGCTAGTAACTATACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140746974_1140746977 7 Left 1140746974 16:77989083-77989105 CCAGCTGTATAGTTACTAGCTGG No data
Right 1140746977 16:77989113-77989135 TGACCAAGTTATTTGATCTCTGG No data
1140746974_1140746979 18 Left 1140746974 16:77989083-77989105 CCAGCTGTATAGTTACTAGCTGG No data
Right 1140746979 16:77989124-77989146 TTTGATCTCTGGACCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140746974 Original CRISPR CCAGCTAGTAACTATACAGC TGG (reversed) Intergenic
No off target data available for this crispr