ID: 1140750419

View in Genome Browser
Species Human (GRCh38)
Location 16:78018458-78018480
Sequence ACAAGGCATTTGGCCAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140750419_1140750427 6 Left 1140750419 16:78018458-78018480 CCTTGGTTGGCCAAATGCCTTGT No data
Right 1140750427 16:78018487-78018509 AGAGAGGCGGTGGGAAGAGAAGG No data
1140750419_1140750422 -7 Left 1140750419 16:78018458-78018480 CCTTGGTTGGCCAAATGCCTTGT No data
Right 1140750422 16:78018474-78018496 GCCTTGTTGCCTTAGAGAGGCGG No data
1140750419_1140750424 -4 Left 1140750419 16:78018458-78018480 CCTTGGTTGGCCAAATGCCTTGT No data
Right 1140750424 16:78018477-78018499 TTGTTGCCTTAGAGAGGCGGTGG No data
1140750419_1140750425 -3 Left 1140750419 16:78018458-78018480 CCTTGGTTGGCCAAATGCCTTGT No data
Right 1140750425 16:78018478-78018500 TGTTGCCTTAGAGAGGCGGTGGG No data
1140750419_1140750421 -10 Left 1140750419 16:78018458-78018480 CCTTGGTTGGCCAAATGCCTTGT No data
Right 1140750421 16:78018471-78018493 AATGCCTTGTTGCCTTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140750419 Original CRISPR ACAAGGCATTTGGCCAACCA AGG (reversed) Intergenic
No off target data available for this crispr