ID: 1140751797

View in Genome Browser
Species Human (GRCh38)
Location 16:78031052-78031074
Sequence CCATTTTATCTGCGTGCACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140751797 Original CRISPR CCATTTTATCTGCGTGCACA TGG (reversed) Exonic
906121584 1:43396020-43396042 CCATTTTATCCTCATGCACCTGG - Intronic
913722003 1:121605842-121605864 CCATTTACTCTGTGTGCACAGGG - Intergenic
913741787 1:121853424-121853446 CCATTTACTCTGTGTGCACAGGG - Intergenic
920736705 1:208539338-208539360 CCATTTTATGTGGGCACACAGGG - Intergenic
922817189 1:228458240-228458262 CTATTCTATCTACGTGTACAAGG + Exonic
922817968 1:228464462-228464484 CTATTCTATCTACGTGTACAAGG - Intergenic
1066459030 10:35597136-35597158 CCATTTTTTGTGTGTGTACAGGG - Intergenic
1068582617 10:58759424-58759446 CCATTTCATATGCCAGCACAAGG - Intronic
1071374955 10:84992845-84992867 ACATTTTATCTGCGTTCTAAAGG - Intergenic
1078964309 11:16320142-16320164 ACCTTTTATCTGTTTGCACAAGG + Intronic
1088887496 11:114019409-114019431 CCATTTTATATGTGAGCAAACGG + Intergenic
1097153863 12:56998486-56998508 CCATTTGATTTGCGGGGACATGG - Intergenic
1100910307 12:99353215-99353237 CCATTTTATCTGTGAGCTCTTGG + Intronic
1102136343 12:110579555-110579577 AAATTTTATCTCTGTGCACAGGG + Intronic
1103750972 12:123160380-123160402 CCATTTTATCTGCTTGCTAATGG + Intronic
1106105549 13:26729735-26729757 CCATTTCATCTATGTTCACAAGG + Intergenic
1107398906 13:40049142-40049164 TCATTTCATCTGGGTGCCCAGGG - Intergenic
1108474629 13:50801569-50801591 CCATTTTCACGGGGTGCACAGGG + Intronic
1109162506 13:58992897-58992919 CCATTCTTTCTGAGTGCACCAGG - Intergenic
1117249536 14:53922712-53922734 CTAGTTTATCTTCCTGCACATGG - Intergenic
1117656145 14:57958812-57958834 CCACTTCATCAGGGTGCACAAGG + Intronic
1125408127 15:39375033-39375055 TCATTTTATCTGCATCCAAAGGG - Intergenic
1125408136 15:39375181-39375203 CCATTTTAGCTGCATCCAAAGGG - Intergenic
1126441847 15:48697881-48697903 CCACTTTGTCTGCAAGCACAGGG - Intergenic
1130096869 15:80862582-80862604 CCATCTTATCTGCATGGAGAGGG - Intronic
1130348809 15:83072230-83072252 CCATTGTTTCTCCCTGCACAGGG - Intergenic
1139031058 16:62881325-62881347 CGATTTTATCTGGGTAGACATGG + Intergenic
1140751797 16:78031052-78031074 CCATTTTATCTGCGTGCACATGG - Exonic
1145033046 17:19519847-19519869 ACATGTTATCTGCCAGCACAGGG - Intronic
1153181842 18:2444243-2444265 CAAATTTATCAGTGTGCACAGGG + Intergenic
1153349020 18:4058470-4058492 GCAGTTTTTCTGCCTGCACAGGG + Intronic
1156048206 18:32901040-32901062 TCATTTTATCTGCGCCCATATGG - Intergenic
1156907321 18:42369626-42369648 CAAATTTATCAACGTGCACATGG + Intergenic
1158284062 18:55859313-55859335 CAATTTTGCCTGCGTGCACTGGG - Intergenic
1160494839 18:79367016-79367038 GCACTTTCTCTGCGTACACACGG - Intronic
1160494845 18:79367075-79367097 GCACTTTCTCTGCGTACACACGG - Intronic
1160494864 18:79367254-79367276 GCACTTTCTCTGCGTACACACGG - Intronic
1160494870 18:79367313-79367335 GCACTTTCTCTGCGTACACACGG - Intronic
1160494880 18:79367431-79367453 GCACTTTCTCTGCGTACACACGG - Intronic
1161251503 19:3282823-3282845 CAATTTAATCTGTGTGCAAAAGG + Intronic
1166253894 19:41589022-41589044 CCATTTTCTCTGCCTACAGAAGG + Intronic
1166434133 19:42752842-42752864 CCATCTTATCTGCAAACACACGG + Intronic
1166656066 19:44613046-44613068 CCATTTTCTCGTGGTGCACAGGG - Intergenic
927282444 2:21321127-21321149 CCATTGTGCCTGGGTGCACAGGG - Intergenic
928413259 2:31070558-31070580 GCAATTTATCGGCGTGCCCAAGG + Intronic
935235674 2:101136333-101136355 CCATGTGATCTGTGTACACAGGG + Intronic
936157176 2:110055494-110055516 CAATTTTACCTCCGTGCAGAGGG - Intergenic
936187518 2:110315950-110315972 CAATTTTACCTCCGTGCAGAGGG + Intergenic
947314937 2:228846672-228846694 CAATTTTAGCTCTGTGCACATGG + Intergenic
1170773994 20:19359451-19359473 CCATGTCATCTGGGTGCAGAGGG + Intronic
1171138690 20:22721988-22722010 CCAGTTTACCTGCGTACAAATGG + Intergenic
1173920338 20:46739946-46739968 CCATCTTCTCTGCTTGCACGTGG + Intergenic
1177721112 21:24908211-24908233 CCATTATGTCTTCGAGCACATGG + Intergenic
955111694 3:55957222-55957244 CCATTTTATCAGGCTGAACAAGG - Intronic
955478902 3:59369144-59369166 CCAATTTATCTGCCAGCTCAGGG - Intergenic
958750284 3:98187221-98187243 CCCTTTTACCGGCTTGCACAGGG + Intronic
960728651 3:120699006-120699028 CCATTTTCTCTTCTAGCACAAGG - Intronic
961948265 3:130717095-130717117 CCATTTTATTTGCATTGACAAGG - Intronic
962893418 3:139692760-139692782 CCATTTTCTCTGGGTACAGATGG + Intergenic
963458670 3:145578514-145578536 GCAGTTTATCTGCCTGCATAGGG - Intergenic
963834797 3:150047467-150047489 CCCTTTTCTCTCCGTGCAAATGG + Intronic
966344424 3:178962705-178962727 CCTTTTTCTCTGTGTGTACAGGG - Intergenic
966927722 3:184656356-184656378 CCATTTTATCTCAGAACACAGGG - Intronic
967204200 3:187104315-187104337 CCTGTGTATGTGCGTGCACAAGG - Intergenic
972594205 4:40516006-40516028 CCGTTTTATCTGCCTGCCCGGGG + Intronic
973082071 4:46005699-46005721 GCATTTTATCTGCCTCCAGATGG + Intergenic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
977456663 4:97270339-97270361 ACATGTTATCTGAGTTCACATGG - Intronic
978563557 4:110058531-110058553 CCATTCTATCTGAATGGACACGG + Intronic
978704315 4:111687937-111687959 CCATTTTATTTTCTTCCACATGG + Intergenic
986453635 5:7892492-7892514 CAATTTTATTTGCTTGCACTAGG - Intronic
988162269 5:27534141-27534163 CCATTTTATTTGAAAGCACAGGG - Intergenic
989956343 5:50365221-50365243 CCATTTACTCTGTGTACACAGGG + Intergenic
995558707 5:113357645-113357667 CCATTTTGCCTTAGTGCACATGG - Intronic
995803981 5:116030442-116030464 CCATTTTTGGTGCATGCACACGG - Intronic
1000332094 5:160213746-160213768 CTGTGTTGTCTGCGTGCACATGG + Exonic
1000771634 5:165362135-165362157 CCATTTAATCTGGGTTCAAAGGG - Intergenic
1006437212 6:34032206-34032228 CCGCTTAATCTGCATGCACATGG + Intronic
1007973778 6:46079655-46079677 CCATAATATCTGCATGAACAGGG + Intronic
1017085527 6:150709635-150709657 CAATTTTATCTTCTTGGACAAGG - Intronic
1017750145 6:157483729-157483751 CCATGTTGTATGTGTGCACATGG + Intronic
1018087885 6:160320678-160320700 CCATTTCATGTGAGTGCAAATGG - Intergenic
1021556557 7:21925191-21925213 CCATTTTGTCTGTGTGGCCATGG - Intronic
1023654218 7:42403704-42403726 CCATTATAACTGGGTCCACAGGG - Intergenic
1027923622 7:84430977-84430999 CTATTATATCTGAGTGTACATGG - Intronic
1030124258 7:106139592-106139614 GCATTTTCACTGCATGCACATGG - Intergenic
1030730504 7:112982342-112982364 CCATTTTATCTGCAGGCATTAGG + Intergenic
1037103722 8:15079760-15079782 CTATTTAATCAGCCTGCACATGG - Intronic
1046189431 8:110772816-110772838 GCCTTTTATCTGCGTGCACATGG - Intergenic
1046503170 8:115104851-115104873 CCATATTATCTGGGTTCATATGG - Intergenic
1052578605 9:30323542-30323564 CCATGTTATCTGCATGTTCAAGG + Intergenic
1056946120 9:90998684-90998706 CCAGTTTATGTGCCTGCAGATGG - Intergenic
1057174572 9:92986695-92986717 GCAGTTTGTCTGCGGGCACAGGG - Intronic
1057919556 9:99085808-99085830 TCATTTTATCTGACTGCAGATGG + Intergenic
1058426483 9:104879673-104879695 CAATTTTGTTTGAGTGCACATGG + Intronic
1186011382 X:5138261-5138283 CCATTGTCTCAGCGTGCACATGG - Intergenic
1186816573 X:13243638-13243660 CAAATTTATCAGTGTGCACATGG + Intergenic
1188576506 X:31657183-31657205 CTATTTTTTCAGCTTGCACAAGG + Intronic
1195727377 X:107932379-107932401 CCATTTAATGTGCGAGGACAGGG + Intergenic
1196832340 X:119785641-119785663 CCACATTATCTCTGTGCACAAGG + Intergenic
1199244525 X:145587551-145587573 CCATTTTATCTACTTGATCATGG - Intergenic