ID: 1140757158

View in Genome Browser
Species Human (GRCh38)
Location 16:78078052-78078074
Sequence CTATTGATGCACAGTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140757154_1140757158 15 Left 1140757154 16:78078014-78078036 CCAATATTTCTTCTAATGAGTTT No data
Right 1140757158 16:78078052-78078074 CTATTGATGCACAGTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140757158 Original CRISPR CTATTGATGCACAGTGAGGG TGG Intergenic
No off target data available for this crispr