ID: 1140757212

View in Genome Browser
Species Human (GRCh38)
Location 16:78078505-78078527
Sequence GCACCATGCCTGGCTAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140757212_1140757215 5 Left 1140757212 16:78078505-78078527 CCTGGATTAGCCAGGCATGGTGC No data
Right 1140757215 16:78078533-78078555 GCCTGTAGTCTCAGCTACTTGGG 0: 1624
1: 39088
2: 171738
3: 262108
4: 227770
1140757212_1140757217 8 Left 1140757212 16:78078505-78078527 CCTGGATTAGCCAGGCATGGTGC No data
Right 1140757217 16:78078536-78078558 TGTAGTCTCAGCTACTTGGGAGG 0: 2492
1: 51171
2: 167340
3: 227924
4: 240776
1140757212_1140757219 18 Left 1140757212 16:78078505-78078527 CCTGGATTAGCCAGGCATGGTGC No data
Right 1140757219 16:78078546-78078568 GCTACTTGGGAGGCTGAGGCAGG 0: 74529
1: 175606
2: 216051
3: 220891
4: 278507
1140757212_1140757218 14 Left 1140757212 16:78078505-78078527 CCTGGATTAGCCAGGCATGGTGC No data
Right 1140757218 16:78078542-78078564 CTCAGCTACTTGGGAGGCTGAGG 0: 5884
1: 102163
2: 212163
3: 251374
4: 263031
1140757212_1140757220 21 Left 1140757212 16:78078505-78078527 CCTGGATTAGCCAGGCATGGTGC No data
Right 1140757220 16:78078549-78078571 ACTTGGGAGGCTGAGGCAGGAGG 0: 4992
1: 13123
2: 59063
3: 125134
4: 206151
1140757212_1140757214 4 Left 1140757212 16:78078505-78078527 CCTGGATTAGCCAGGCATGGTGC No data
Right 1140757214 16:78078532-78078554 TGCCTGTAGTCTCAGCTACTTGG 0: 1901
1: 39485
2: 139836
3: 149174
4: 130338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140757212 Original CRISPR GCACCATGCCTGGCTAATCC AGG (reversed) Intergenic
No off target data available for this crispr