ID: 1140758807

View in Genome Browser
Species Human (GRCh38)
Location 16:78092579-78092601
Sequence GGAAAACCCTGCAGAGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140758807_1140758811 2 Left 1140758807 16:78092579-78092601 CCATGACCTCTGCAGGGTTTTCC No data
Right 1140758811 16:78092604-78092626 CAGCAATTATTCTTTCTCCAGGG No data
1140758807_1140758810 1 Left 1140758807 16:78092579-78092601 CCATGACCTCTGCAGGGTTTTCC No data
Right 1140758810 16:78092603-78092625 GCAGCAATTATTCTTTCTCCAGG No data
1140758807_1140758812 17 Left 1140758807 16:78092579-78092601 CCATGACCTCTGCAGGGTTTTCC No data
Right 1140758812 16:78092619-78092641 CTCCAGGGTCCAGTCGCCTCAGG No data
1140758807_1140758813 18 Left 1140758807 16:78092579-78092601 CCATGACCTCTGCAGGGTTTTCC No data
Right 1140758813 16:78092620-78092642 TCCAGGGTCCAGTCGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140758807 Original CRISPR GGAAAACCCTGCAGAGGTCA TGG (reversed) Intergenic
No off target data available for this crispr